local cloneref = (cloneref or clonereference or function(i) return i end) local RunService = game:GetService("RunService") local HttpService = game:GetService("HttpService") do local E = Encrypt if type(E) ~= "table" then E = {} if type(Encrypt) == "function" then E.encode = Encrypt end end E.start = E.start or function() end E["end"] = E["end"] or function() end Encrypt = E end local Library = loadstring(game:HttpGet("https://raw.githubusercontent.com/deividcomsono/Obsidian/main/Library.lua"))() local ThemeManager = loadstring(game:HttpGet("https://raw.githubusercontent.com/brojstypingshit-prog/savemanagerhollyyyy/refs/heads/main/ThemeManager.luau"))() local SaveManager = loadstring(game:HttpGet("https://raw.githubusercontent.com/brojstypingshit-prog/savemanagerhollyyyy/refs/heads/main/SaveManager.luau"))() local Options = Library.Options local Toggles = Library.Toggles MainModule = MainModule or {} MainModule.Keybinds = MainModule.Keybinds or {} MainModule._KeybindPress = MainModule._KeybindPress or {} local function HSXNotify(a, b, c) local title, content, dur = "HollyScriptX", "", 0.9 if type(a) == "table" then title = tostring(a.Title or a.title or "HollyScriptX") content = tostring(a.Description or a.Content or a.text or a.Desc or "") dur = tonumber(a.Duration or a.duration) or 0.9 elseif type(a) == "string" then title = a content = tostring(b or "") dur = tonumber(c) or 0.9 end local msg = content ~= "" and (title .. " | " .. content) or title pcall(function() Library:Notify(msg, dur) end) end function Library:SetNotifySide(side) pcall(function() if Library.NotifySide ~= nil then Library.NotifySide = side end end) end MainModule._HSX_Side = {} function MainModule.wrapGroupbox(gb) local s = {} s._raw = gb function s:Toggle(opts) opts = opts or {} local id = opts.Id or opts.Title or ("T" .. tostring(math.random(100000,999999))) id = tostring(id):gsub("%s+", "") local userCb = opts.Callback local tog = gb:AddToggle(id, { Text = opts.Title or id, Default = opts.Value and true or false, Tooltip = opts.Desc or opts.Tooltip, Callback = function(v) if MainModule and MainModule._SuppressUI then return end if userCb then pcall(userCb, v) end end, }) if MainModule then MainModule._AllToggleRefs = MainModule._AllToggleRefs or {} MainModule._AllToggleRefs[id] = tog end if MainModule.ToggleRefs then MainModule.ToggleRefs[id] = tog end return tog end function s:Button(opts) if type(opts) == "string" then local title = opts return function(_, cb) return gb:AddButton({ Text = title, Func = function() if cb then pcall(cb) end end }) end end opts = opts or {} return gb:AddButton({ Text = opts.Title or opts.Text or "Button", Func = function() if opts.Callback then pcall(opts.Callback) end end, Tooltip = opts.Desc or opts.Tooltip, }) end function s:Slider(opts) opts = opts or {} local id = opts.Id or opts.Title or ("S" .. tostring(math.random(100000,999999))) id = tostring(id):gsub("%s+", "") local range = opts.Value or {} local min = range.Min or opts.Min or 0 local max = range.Max or opts.Max or 100 local def = range.Default or opts.Default or min local userCb = opts.Callback return gb:AddSlider(id, { Text = opts.Title or id, Default = def, Min = min, Max = max, Rounding = opts.Step and (opts.Step < 1 and 1 or 0) or 0, Callback = function(v) if userCb then pcall(userCb, v) end end, }) end function s:Dropdown(opts) opts = opts or {} local id = opts.Id or opts.Title or ("D" .. tostring(math.random(100000,999999))) id = tostring(id):gsub("%s+", "") local userCb = opts.Callback return gb:AddDropdown(id, { Text = opts.Title or id, Values = opts.Values or {}, Default = opts.Value or opts.Default, Callback = function(v) if userCb then pcall(userCb, v) end end, }) end function s:Input(opts) opts = opts or {} local id = opts.Id or opts.Title or ("I" .. tostring(math.random(100000,999999))) id = tostring(id):gsub("%s+", "") local userCb = opts.Callback return gb:AddInput(id, { Text = opts.Title or id, Default = opts.Value or opts.Default or "", Placeholder = opts.Placeholder, Callback = function(v) if userCb then pcall(userCb, v) end end, }) end function s:Paragraph(opts) opts = opts or {} local text = type(opts) == "string" and opts or (opts.Title or opts.Text or "") local lbl = gb:AddLabel(tostring(text)) function lbl:SetTitle(t) pcall(function() if lbl.SetText then lbl:SetText(t) end end) end return lbl end function s:Colorpicker(opts) opts = opts or {} local id = opts.Id or opts.Title or ("C" .. tostring(math.random(100000,999999))) id = tostring(id):gsub("%s+", ""):gsub("[^%w_]", "") local userCb = opts.Callback local def = opts.Default or opts.Value or Color3.fromRGB(255,255,255) local title = opts.Title or id local res pcall(function() local label = gb:AddLabel(title) res = label:AddColorPicker(id, { Default = def, Title = title, Callback = function(v) if userCb then pcall(userCb, v) end end, }) end) return res end function s:Keybind(opts) opts = opts or {} local id = opts.Id or opts.Title or ("K" .. tostring(math.random(100000,999999))) id = tostring(id):gsub("%s+", "") local userCb = opts.Callback local label = gb:AddLabel(opts.Title or id) local kp pcall(function() kp = label:AddKeyPicker(id, { Default = opts.Value or opts.Default or "None", Mode = "Hold", Text = opts.Title or id, NoUI = opts.NoUI ~= false, Callback = function(v) if userCb then local name = typeof(v) == "EnumItem" and v.Name or tostring(v) if name == "true" or name == "false" then return end pcall(userCb, name) end end, }) end) return kp or label end function s:AddKeyPicker(idx, info) return gb:AddLabel(info and info.Text or idx):AddKeyPicker(idx, info) end return s end function MainModule.wrapTab(tab) local t = {} local side = 0 function t:Section(opts) opts = opts or {} local title = opts.Title or "Section" local icon = opts.Icon side = side + 1 local gb if side % 2 == 1 then gb = tab:AddLeftGroupbox(title, icon) else gb = tab:AddRightGroupbox(title, icon) end return MainModule.wrapGroupbox(gb) end function t:AddLeftGroupbox(title, icon) return MainModule.wrapGroupbox(tab:AddLeftGroupbox(title, icon)) end function t:AddRightGroupbox(title, icon) return MainModule.wrapGroupbox(tab:AddRightGroupbox(title, icon)) end return t end WindUI = { Window = nil, Notify = function(_, opts) local title = opts and (opts.Title or "HollyScriptX") or "HollyScriptX" local content = opts and (opts.Content or opts.Description or "") or "" HSXNotify(title, content, opts and opts.Duration or 0.9) end, SetTheme = function() end, GetThemes = function() return {} end, ToggleAcrylic = function() end, Destroy = function() end, } local Players = game:GetService("Players") local ReplicatedStorage = game:GetService("ReplicatedStorage") local Workspace = game:GetService("Workspace") local RunService = game:GetService("RunService") local UserInputService = game:GetService("UserInputService") local CoreGui = game:GetService("CoreGui") local HttpService = game:GetService("HttpService") local Stats = game:GetService("Stats") local SoundService = game:GetService("SoundService") local TweenService = game:GetService("TweenService") local LocalPlayer = Players.LocalPlayer MainModule.ToggleRefs = MainModule.ToggleRefs or {} MainModule.ToggleGameRequirements = MainModule.ToggleGameRequirements or {} MainModule.guiCreated = false MainModule.pendingNotifications = {} local function SafeDestroy(obj) if obj and obj.Parent then pcall(function() obj:Destroy() end) end end local function GetDistance(pos1, pos2) return (pos1 - pos2).Magnitude end MainModule = MainModule or {} MainModule.get_character = function() return LocalPlayer.Character end MainModule.get_humanoid = function(c) return c and c:FindFirstChildOfClass("Humanoid") end MainModule.get_root_part = function(c) return c and c:FindFirstChild("HumanoidRootPart") end local function removeCursorUI() local playerGui = game:GetService("Players").LocalPlayer:FindFirstChild("PlayerGui") if not playerGui then return end local cursorUI = playerGui:FindFirstChild("HollyScriptX_Cursor") if cursorUI then cursorUI:Destroy() end end removeCursorUI() MainModule.is_xeno_executor = function() if identifyexecutor and type(identifyexecutor) == "function" then local executor = identifyexecutor():lower() if executor:find("xeno") or executor:find("Xeno") then return true end end return false end MainModule.is_feature_supported = function(featureName) if MainModule.is_xeno_executor() then local unsupportedFeatures = {"AutoDodge", "FreeGuard", "AutoQTE", "Desync"} for _, f in ipairs(unsupportedFeatures) do if f == featureName then return false end end end return true end MainModule.update_toggle_availability = function(toggleName, gameName, toggleRef) local isGameActive = false if gameName then local values = Workspace:FindFirstChild("Values") if values then local currentGame = values:FindFirstChild("CurrentGame") isGameActive = currentGame and currentGame.Value == gameName end else isGameActive = true end local isSupported = MainModule.is_feature_supported(toggleName) if toggleRef and toggleRef.SetDisabled then local shouldDisable = (not isGameActive and gameName ~= nil) or not isSupported pcall(function() toggleRef:SetDisabled(shouldDisable) end) if toggleRef.Value == true and not isGameActive and gameName ~= nil then pcall(function() toggleRef:SetValue(false) end) end end end MainModule.notify = function(title, text, duration) local d = tonumber(duration) or 0.9 if MainModule.guiCreated then HSXNotify({Title = title, Description = text, Duration = d}) else table.insert(MainModule.pendingNotifications, {title = title, text = text, duration = d}) pcall(function() HSXNotify({Title = title, Description = text, Duration = d}) end) end end MainModule.SpectateModeEnabled = false function MainModule.toggle_spectate_mode(enabled) enabled = enabled and true or false MainModule.SpectateModeEnabled = enabled pcall(function() local values = workspace:FindFirstChild("Values") if not values then return end local canSpectate = values:FindFirstChild("CanSpectateIfWonGame") if canSpectate and canSpectate:IsA("ValueBase") then canSpectate.Value = enabled end end) PlayToggleSound() return true end MainModule.RapidFireEnabled = false MainModule.OriginalFireRates = {} MainModule.RapidFireConnection = nil function MainModule.toggle_rapid_fire(enabled) MainModule.RapidFireEnabled = enabled if enabled then if MainModule.RapidFireConnection then return end MainModule.RapidFireConnection = RunService.Heartbeat:Connect(function() if not MainModule.RapidFireEnabled then return end pcall(function() local w = ReplicatedStorage:FindFirstChild("Weapons") if w and w:FindFirstChild("Guns") then for _, o in pairs(w.Guns:GetDescendants()) do if o.Name == "FireRateCD" and (o:IsA("NumberValue") or o:IsA("IntValue")) then if not MainModule.OriginalFireRates[o] then MainModule.OriginalFireRates[o] = o.Value end o.Value = 0 end end end local c = MainModule.get_character and MainModule.get_character() or MainModule.GetCharacter and MainModule.GetCharacter() if c then for _, t in pairs(c:GetChildren()) do if t:IsA("Tool") then for _, o in pairs(t:GetDescendants()) do if o.Name == "FireRateCD" and (o:IsA("NumberValue") or o:IsA("IntValue")) then if not MainModule.OriginalFireRates[o] then MainModule.OriginalFireRates[o] = o.Value end o.Value = 0 end end end end end end) end) else if MainModule.RapidFireConnection then MainModule.RapidFireConnection:Disconnect() MainModule.RapidFireConnection = nil end for o, v in pairs(MainModule.OriginalFireRates) do if o and o.Parent then o.Value = v else MainModule.OriginalFireRates[o] = nil end end MainModule.OriginalFireRates = {} end if MainModule.ToggleRefs.RapidFire then MainModule.ToggleRefs.RapidFire:SetValue(enabled) end PlayToggleSound() end loadstring([[ function LPH_NO_VIRTUALIZE(f) return f end; ]])(); loadstring([[ function LPH_NO_VIRTUALIZE(f) return f end; ]])(); --@encrypt_start loadstring([[ function LPH_NO_VIRTUALIZE(f) return f end; ]])(); MainModule.PentathlonConnections = {} MainModule.PentathlonStates = {} local gameCache = {obj = nil, time = 0} local activeCache = {val = false, time = 0} local function findActivePentathlonGame() local char = LocalPlayer.Character if not char then return nil end local ok, result = pcall(function() for _, obj in ipairs(getgc(true)) do if type(obj) == "table" and rawget(obj, "GUID") and rawget(obj, "Players") and rawget(obj, "Active") then local players = rawget(obj, "Players") if type(players) == "table" then for _, v in pairs(players) do if v == char then return obj end end end end end return nil end) return ok and result or nil end local function getCachedGame() if tick() - gameCache.time > 2 then gameCache.time = tick() gameCache.obj = findActivePentathlonGame() end return gameCache.obj end local function isPentathlonActive() if tick() - activeCache.time > 0.5 then activeCache.time = tick() activeCache.val = LocalPlayer:GetAttribute("InPentathlon") == true or Workspace:FindFirstChild("PentathlonMap") ~= nil end return activeCache.val end local function getPentathlonClient() local ok, mod = pcall(function() return require(ReplicatedStorage.Modules.Games.PentathlonClient) end) return ok and mod or nil end local function stopPentathlonAuto(name) if MainModule.PentathlonConnections[name] then MainModule.PentathlonConnections[name]:Disconnect() MainModule.PentathlonConnections[name] = nil end MainModule.PentathlonStates[name] = nil end MainModule.AutoDdakji = false function MainModule.toggle_auto_ddakji(enabled) MainModule.AutoDdakji = enabled stopPentathlonAuto("Ddakji") if enabled then local Client = getPentathlonClient() if not Client then PlayToggleSound() return end local POWER = 0.9512388499560662 local POSITION = Vector3.new(-147.3336944580078, 6001.07568359375, -19.965335845947266) local lastAction = 0 MainModule.PentathlonConnections["Ddakji"] = task.spawn(function() while MainModule.AutoDdakji do if not isPentathlonActive() then break end if tick() - lastAction >= 1.5 then local game = getCachedGame() if game and game.Active and game.CurrentPlayer == LocalPlayer.Character then pcall(function() Client.RunServerGame(game, "Thrown", {Power = POWER, Position = POSITION}) end) lastAction = tick() end end task.wait(0.1) end stopPentathlonAuto("Ddakji") end) end PlayToggleSound() end MainModule.AutoFlyingStone = false function MainModule.toggle_auto_flying_stone(enabled) MainModule.AutoFlyingStone = enabled stopPentathlonAuto("FlyingStone") if enabled then local Client = getPentathlonClient() if not Client then PlayToggleSound() return end local lastAction = 0 local standCache = {stand = nil, game = nil} MainModule.PentathlonConnections["FlyingStone"] = task.spawn(function() while MainModule.AutoFlyingStone do if not isPentathlonActive() then break end if tick() - lastAction >= 1.5 then local game = getCachedGame() if game and game.Active and game.CurrentPlayer == LocalPlayer.Character then local character = LocalPlayer.Character local hrp = character and character:FindFirstChild("HumanoidRootPart") if hrp then if not standCache.stand or standCache.game ~= game then standCache.game = game local map = Workspace:FindFirstChild("PentathlonMap") standCache.stand = map and map:FindFirstChild("Stand", true) end local targetPos if standCache.stand and standCache.stand:FindFirstChild("Target") then targetPos = standCache.stand.Target.Position else targetPos = hrp.Position + hrp.CFrame.LookVector * 20 end local origin = hrp.Position + Vector3.new(0,1.5,0) local direction = (targetPos - origin).Unit pcall(function() Client.RunServerGame(game, "Thrown", {ThrowPower = "Perfect", Origin = origin, Direction = direction}) end) lastAction = tick() end end end task.wait(0.1) end stopPentathlonAuto("FlyingStone") end) end PlayToggleSound() end MainModule.AutoGonggi = false function MainModule.toggle_auto_gonggi(enabled) MainModule.AutoGonggi = enabled stopPentathlonAuto("Gonggi") if enabled then local Client = getPentathlonClient() if not Client then PlayToggleSound() return end local lastAction = 0 local collectedPieces = {} local lastGame = nil MainModule.PentathlonConnections["Gonggi"] = task.spawn(function() while MainModule.AutoGonggi do if not isPentathlonActive() then break end local game = getCachedGame() if game and game.Active and game.CurrentPlayer == LocalPlayer.Character and tick() - lastAction >= 2.5 then if game ~= lastGame then lastGame = game table.clear(collectedPieces) end local map = Workspace:FindFirstChild("PentathlonMap") if map then local pieceToGrab for _, obj in ipairs(map:GetDescendants()) do if obj:IsA("BasePart") and obj:FindFirstChild("GrabHighlight") and not collectedPieces[obj.Name] then pieceToGrab = obj break end end if pieceToGrab then collectedPieces[pieceToGrab.Name] = true lastAction = tick() task.spawn(function() task.wait(0.4) if game and game.Active then pcall(function() Client.RunServerGame(game, "GotPiece", {Name = pieceToGrab.Name}) end) end task.wait(0.3) if game and game.Active then local allDone = true for _, p in ipairs(map:GetDescendants()) do if p:IsA("BasePart") and p:FindFirstChild("GrabHighlight") and not collectedPieces[p.Name] then allDone = false break end end if allDone then pcall(function() Client.RunServerGame(game, "TimeSlowFinish") end) end end end) end end end task.wait(0.1) end stopPentathlonAuto("Gonggi") end) end PlayToggleSound() end MainModule.AutoSpinningTop = false function MainModule.toggle_auto_spinning_top(enabled) MainModule.AutoSpinningTop = enabled stopPentathlonAuto("SpinningTop") if enabled then local Client = getPentathlonClient() if not Client then PlayToggleSound() return end local phase = "Tie" local hooked = false local lastAction = 0 local lastGame = nil local function hookGame(g) if hooked or not g or not g.HandleRequest then return end local original = g.HandleRequest g.HandleRequest = function(self, cmd, data, ...) if cmd == "Aim" then phase = "Aim" elseif cmd == "SetPlayer" or cmd == "Restart" then phase = "Tie" elseif cmd == "Reset" then phase = nil end return original(self, cmd, data, ...) end hooked = true end MainModule.PentathlonConnections["SpinningTop"] = task.spawn(function() while MainModule.AutoSpinningTop do if not isPentathlonActive() then break end local game = getCachedGame() if game and game.Active then if game ~= lastGame then lastGame = game hooked = false phase = "Tie" hookGame(game) end if game.CurrentPlayer == LocalPlayer.Character then local now = tick() if phase == "Tie" and now - lastAction > 0.3 then pcall(function() Client.RunServerGame(game, "Tied", {}) end) lastAction = now elseif phase == "Aim" and now - lastAction > 1.5 then pcall(function() Client.RunServerGame(game, "Thrown", {}) end) lastAction = now end end end task.wait(0.1) end stopPentathlonAuto("SpinningTop") end) end PlayToggleSound() end MainModule.AutoJegi = false function MainModule.toggle_auto_jegi(enabled) MainModule.AutoJegi = enabled stopPentathlonAuto("Jegi") if enabled then local Client = getPentathlonClient() if not Client then PlayToggleSound() return end local lastKick = 0 MainModule.PentathlonConnections["Jegi"] = task.spawn(function() while MainModule.AutoJegi do if not isPentathlonActive() then break end if tick() - lastKick >= 0.8 then local game = getCachedGame() if game and game.Active and game.CurrentPlayer == LocalPlayer.Character then pcall(function() Client.RunServerGame(game, "Kick", {Lose = false}) end) lastKick = tick() end end task.wait(0.1) end stopPentathlonAuto("Jegi") end) end PlayToggleSound() end --@encrypt_end MainModule.DalgonaAutoRelax = false MainModule.DalgonaAutoRelaxConnection = nil MainModule.DalgonaLastRelax = 0 function MainModule.toggle_dalgona_auto_relax(enabled) MainModule.DalgonaAutoRelax = enabled if MainModule.DalgonaAutoRelaxConnection then MainModule.DalgonaAutoRelaxConnection:Disconnect() MainModule.DalgonaAutoRelaxConnection = nil end if enabled then MainModule.DalgonaLastRelax = 0 MainModule.DalgonaAutoRelaxConnection = RunService.Heartbeat:Connect(function() if not MainModule.DalgonaAutoRelax then return end if tick() - MainModule.DalgonaLastRelax < 5 then return end local playerGui = LocalPlayer:FindFirstChild("PlayerGui") if not playerGui then return end local dalgonaUI = playerGui:FindFirstChild("DalgonaUI") if not dalgonaUI then return end local breathing = dalgonaUI:FindFirstChild("Breathing") if not breathing or not breathing.Visible then return end local breath = breathing:FindFirstChild("Breath") if not breath then return end local crackBar = breathing:FindFirstChild("CrackProgressBar") if not crackBar then return end local shadow = crackBar:FindFirstChild("ChanceShadow") local chance = shadow and shadow:FindFirstChild("Chance") local text = chance and chance.Text or "0%" local percent = tonumber(text:match("(%d+)")) or 0 if percent <= 0 or percent >= 95 then return end pcall(function() firesignal(breath.MouseButton1Click) end) MainModule.DalgonaLastRelax = tick() end) end PlayToggleSound() end MainModule.TugOfWarAutoQTEMiss = false MainModule.TugOfWarAutoQTEMissConnection = nil MainModule.TugOfWarAutoPull = false MainModule.TugOfWarAutoPullConnection = nil MainModule.TugOfWarUltraFastPull = false MainModule.TugOfWarUltraFastPullConnection = nil MainModule.TugOfWarUltraFastPullMissConnection = nil local function findTugOfWarCircle() local playerGui = LocalPlayer:FindFirstChild("PlayerGui") if not playerGui then return nil end local ui = playerGui:FindFirstChild("TugOfWarUIV2") or playerGui:FindFirstChild("TugOfWarUI") or playerGui:FindFirstChild("TugofWarRemake") if not ui then return nil end local remake = ui:FindFirstChild("TugofWarRemake") or ui local circle = remake and remake:FindFirstChild("CircleBase") if circle and circle.Visible then return circle end return nil end function MainModule.toggle_tug_of_war_auto_qte_miss(enabled) MainModule.TugOfWarAutoQTEMiss = enabled if MainModule.TugOfWarAutoQTEMissConnection then MainModule.TugOfWarAutoQTEMissConnection:Disconnect() MainModule.TugOfWarAutoQTEMissConnection = nil end if enabled then MainModule.TugOfWarAutoQTEMissConnection = RunService.RenderStepped:Connect(function() if not MainModule.TugOfWarAutoQTEMiss then return end if LocalPlayer:GetAttribute("TugOfWarPhase") ~= "QTE" then return end local circle = findTugOfWarCircle() if not circle then return end local arrow = circle:FindFirstChild("Arrow") local medium = circle:FindFirstChild("Medium") if not arrow or not medium then return end medium.Rotation = arrow.Rotation end) end PlayToggleSound() end function MainModule.toggle_tug_of_war_auto_pull(enabled) MainModule.TugOfWarAutoPull = enabled if MainModule.TugOfWarAutoPullConnection then MainModule.TugOfWarAutoPullConnection:Disconnect() MainModule.TugOfWarAutoPullConnection = nil end if enabled then local function startLoop() MainModule.TugOfWarAutoPullConnection = RunService.Heartbeat:Connect(function() if not MainModule.TugOfWarAutoPull then return end if LocalPlayer:GetAttribute("TugOfWarPhase") ~= "QTE" then return end local circle = findTugOfWarCircle() if not circle or not circle.Visible then return end local arrow = circle:FindFirstChild("Arrow") local medium = circle:FindFirstChild("Medium") local btn = circle:FindFirstChild("TextButton") if not arrow or not medium or not btn then return end local strategy = LocalPlayer:GetAttribute("TugOfWarStrategy") or "Standard" local hitZone = 26 if strategy == "Stall" then hitZone = math.floor(26 * 0.8) end local diff = (medium.Rotation - arrow.Rotation + 180) % 360 - 180 if math.abs(diff) <= hitZone then pcall(function() firesignal(btn.MouseButton1Click) end) end end) end startLoop() LocalPlayer:GetAttributeChangedSignal("TugOfWarPhase"):Connect(function() if LocalPlayer:GetAttribute("TugOfWarPhase") ~= "QTE" then if MainModule.TugOfWarAutoPullConnection then MainModule.TugOfWarAutoPullConnection:Disconnect() MainModule.TugOfWarAutoPullConnection = nil end else if MainModule.TugOfWarAutoPull then startLoop() end end end) end PlayToggleSound() end function MainModule.toggle_tug_of_war_ultra_fast_pull(enabled) MainModule.TugOfWarUltraFastPull = enabled if MainModule.TugOfWarUltraFastPullConnection then MainModule.TugOfWarUltraFastPullConnection:Disconnect() MainModule.TugOfWarUltraFastPullConnection = nil end if MainModule.TugOfWarUltraFastPullMissConnection then MainModule.TugOfWarUltraFastPullMissConnection:Disconnect() MainModule.TugOfWarUltraFastPullMissConnection = nil end if enabled then MainModule.TugOfWarUltraFastPullMissConnection = RunService.RenderStepped:Connect(function() if not MainModule.TugOfWarUltraFastPull then return end if LocalPlayer:GetAttribute("TugOfWarPhase") ~= "QTE" then return end local circle = findTugOfWarCircle() if not circle then return end local arrow = circle:FindFirstChild("Arrow") local medium = circle:FindFirstChild("Medium") if not arrow or not medium then return end medium.Rotation = arrow.Rotation end) MainModule.TugOfWarUltraFastPullConnection = RunService.Heartbeat:Connect(function() if not MainModule.TugOfWarUltraFastPull then return end if LocalPlayer:GetAttribute("TugOfWarPhase") ~= "QTE" then return end local circle = findTugOfWarCircle() if not circle or not circle.Visible then return end local arrow = circle:FindFirstChild("Arrow") local medium = circle:FindFirstChild("Medium") local btn = circle:FindFirstChild("TextButton") if not arrow or not medium or not btn then return end local diff = (medium.Rotation - arrow.Rotation + 180) % 360 - 180 if math.abs(diff) <= 26 then pcall(function() firesignal(btn.MouseButton1Click) end) end end) end PlayToggleSound() end MainModule.AutoRespawnOnFall = { Enabled = false, Connection = nil, FallHeight = 950, TeleportPosition = Vector3.new(0, 966, -6), HasTeleported = false } function MainModule.toggle_auto_respawn_on_fall(enabled) local toggleRef = MainModule.ToggleRefs.AutoRespawnOnFall MainModule.AutoRespawnOnFall.Enabled = enabled MainModule.AutoRespawnOnFall.HasTeleported = false if MainModule.AutoRespawnOnFall.Connection then MainModule.AutoRespawnOnFall.Connection:Disconnect() MainModule.AutoRespawnOnFall.Connection = nil end if enabled then MainModule.AutoRespawnOnFall.Connection = RunService.Heartbeat:Connect(function() if not MainModule.AutoRespawnOnFall.Enabled then return end if MainModule.is_game_active and not MainModule.is_game_active("SkySquidGame") then return end local character = MainModule.get_character() if not character then return end local rootPart = MainModule.get_root_part(character) if not rootPart then return end local currentY = rootPart.Position.Y if currentY <= MainModule.AutoRespawnOnFall.FallHeight and not MainModule.AutoRespawnOnFall.HasTeleported then rootPart.CFrame = CFrame.new(MainModule.AutoRespawnOnFall.TeleportPosition) MainModule.AutoRespawnOnFall.HasTeleported = true PlayBell() end if currentY > MainModule.AutoRespawnOnFall.FallHeight then MainModule.AutoRespawnOnFall.HasTeleported = false end end) end PlayToggleSound() end MainModule.VoidKillSettings = { Enabled = false, Conn = nil, CharConn = nil, Platform = nil, BackupPlatform = nil } MainModule.VoidAnimIds = { "rbxassetid://107989020363293", "rbxassetid://95016887526212", "rbxassetid://81454586970343" } function MainModule.toggle_void_kill(enabled) local toggleRef = MainModule.ToggleRefs.VoidKill if enabled then if not MainModule.is_game_active("SkySquidGame") then HSXNotify("Void Kill", "Wait for SkySquidGame!", 0.9) PlayErrorSound() if toggleRef and toggleRef.SetValue then pcall(function() toggleRef:SetValue(false) end) end return false end end if not enabled then if MainModule.VoidKillSettings.Conn then MainModule.VoidKillSettings.Conn:Disconnect() MainModule.VoidKillSettings.Conn = nil end if MainModule.VoidKillSettings.CharConn then MainModule.VoidKillSettings.CharConn:Disconnect() MainModule.VoidKillSettings.CharConn = nil end if MainModule.VoidKillSettings.Platform then MainModule.VoidKillSettings.Platform:Destroy() MainModule.VoidKillSettings.Platform = nil end if MainModule.VoidKillSettings.BackupPlatform then MainModule.VoidKillSettings.BackupPlatform:Destroy() MainModule.VoidKillSettings.BackupPlatform = nil end PlayToggleSound() return true end MainModule.VoidKillSettings.Enabled = enabled local function setup(char) local h = char:FindFirstChildOfClass("Humanoid") if not h then return end MainModule.VoidKillSettings.Conn = h.AnimationPlayed:Connect(function(track) if not MainModule.VoidKillSettings.Enabled then return end if track.Animation and table.find(MainModule.VoidAnimIds, track.Animation.AnimationId) then local rootPart = char:FindFirstChild("HumanoidRootPart") if not rootPart then return end local currentStartPos = rootPart.CFrame local randomAngle = math.random() * math.pi * 2 local randomRadius = 63 local offsetX = math.cos(randomAngle) * randomRadius local offsetZ = math.sin(randomAngle) * randomRadius local teleportPos = currentStartPos.Position + Vector3.new(offsetX, 0, offsetZ) local teleportCFrame = CFrame.new(teleportPos + Vector3.new(0, 0.5, 0)) if MainModule.VoidKillSettings.Platform then MainModule.VoidKillSettings.Platform:Destroy() end if MainModule.VoidKillSettings.BackupPlatform then MainModule.VoidKillSettings.BackupPlatform:Destroy() end local platform = Instance.new("Part") platform.Name = HttpService:GenerateGUID(false) platform.Size = Vector3.new(240, 3, 240) platform.Material = Enum.Material.Plastic platform.Position = teleportPos + Vector3.new(0, -3, 0) platform.Anchored = true platform.CanCollide = true platform.Transparency = 0.5 platform.Parent = workspace local backupPlatform = Instance.new("Part") backupPlatform.Name = HttpService:GenerateGUID(false) backupPlatform.Size = Vector3.new(240, 2, 240) backupPlatform.Position = teleportPos + Vector3.new(0, -7, 0) backupPlatform.Anchored = true backupPlatform.CanCollide = true backupPlatform.Transparency = 1 backupPlatform.Parent = workspace MainModule.VoidKillSettings.Platform = platform MainModule.VoidKillSettings.BackupPlatform = backupPlatform rootPart.CFrame = teleportCFrame if char.PrimaryPart then char:SetPrimaryPartCFrame(teleportCFrame) end local stopConn stopConn = track.Stopped:Connect(function() task.wait(1.5) if char and char.Parent and MainModule.VoidKillSettings.Enabled then local returnRoot = char:FindFirstChild("HumanoidRootPart") if returnRoot then returnRoot.CFrame = currentStartPos if char.PrimaryPart then char:SetPrimaryPartCFrame(currentStartPos) end end end task.wait(1.5) if platform then platform:Destroy() end if backupPlatform then backupPlatform:Destroy() end MainModule.VoidKillSettings.Platform = nil MainModule.VoidKillSettings.BackupPlatform = nil if stopConn then stopConn:Disconnect() end end) end end) end if LocalPlayer.Character then setup(LocalPlayer.Character) end MainModule.VoidKillSettings.CharConn = LocalPlayer.CharacterAdded:Connect(function(char) task.wait(1) if MainModule.VoidKillSettings.Enabled then setup(char) end end) PlayToggleSound() return true end MainModule.AutoSkipEnabled = false MainModule.AutoSkipLoop = nil MainModule.toggle_auto_skip = function(enabled) MainModule.AutoSkipEnabled = enabled if MainModule.AutoSkipLoop then task.cancel(MainModule.AutoSkipLoop) MainModule.AutoSkipLoop = nil end if enabled then MainModule.AutoSkipLoop = task.spawn(function() while MainModule.AutoSkipEnabled do pcall(function() local remotes = ReplicatedStorage:FindFirstChild("Remotes") if remotes then local dialogueRemote = remotes:FindFirstChild("DialogueRemote") if dialogueRemote then dialogueRemote:FireServer("Skipped") end local reachableBindable = remotes:FindFirstChild("TemporaryReachedBindable") if reachableBindable then reachableBindable:FireServer() end end end) task.wait(0.8) end end) else end PlayToggleSound() end function MainModule.AntiCrack() local effectsWorkspace = workspace:FindFirstChild("Effects") if effectsWorkspace then for _, outline in ipairs(effectsWorkspace:GetChildren()) do if outline.Name and outline.Name:find("Outline") then for _, part in ipairs(outline:GetDescendants()) do if part:IsA("BasePart") and part.Name ~= "DalgonaClickPart" then pcall(function() local clickPart = part:Clone() clickPart.Name = "DalgonaClickPart" clickPart.Parent = part.Parent clickPart.Size = Vector3.new(1, 1, 1) clickPart.Transparency = 1 clickPart.CanCollide = false clickPart.Anchored = true clickPart.Position = part.Position end) end end end end end end MainModule.anti_crack = MainModule.AntiCrack MainModule.toggle_anti_crack = function() MainModule.AntiCrack() PlayToggleSound() return true end loadstring([[ function LPH_NO_VIRTUALIZE(f) return f end; ]])(); loadstring([[ function LPH_NO_VIRTUALIZE(f) return f end; ]])(); --@encrypt_start loadstring([[ function LPH_NO_VIRTUALIZE(f) return f end; ]])(); MainModule.AutoDalgonaEnabled = false MainModule.AutoDalgonaConnections = {} MainModule.AutoDalgonaTasks = {} MainModule._DalgonaProgressHooked = false local function killCracks() local effects = workspace:FindFirstChild("Effects") if not effects then return end for _, obj in ipairs(effects:GetChildren()) do if obj.Name and ( obj.Name:find("Crack") or obj.Name:find("Shattered") or obj.Name:find("Fragment") ) then pcall(function() obj:Destroy() end) end end end local function blockNewCracks() local effects = workspace:FindFirstChild("Effects") if not effects then return end local connection = effects.ChildAdded:Connect(function(child) if child.Name and ( child.Name:find("Crack") or child.Name:find("Shattered") or child.Name:find("Fragment") ) then pcall(function() child:Destroy() end) end end) table.insert(MainModule.AutoDalgonaConnections, connection) end local function forceDalgonaProgress100() if not getgc or not debug then return false end local getups = debug.getupvalues or debug.get_upvalues local setup = debug.setupvalue or debug.setup_value local getconsts = debug.getconstants or debug.get_constants if not getups or not setup then return false end local patched = false local list = getgc() for _, fn in ipairs(list) do if type(fn) == "function" then local consts = nil if getconsts then local okc, cs = pcall(getconsts, fn) if okc then consts = cs end end local hasCompleted = false local hasProgress = false if type(consts) == "table" then for _, const in pairs(consts) do if const == "Completed" then hasCompleted = true end if type(const) == "string" and (const == "Progress" or const:find("%%", 1, true)) then hasProgress = true end end end if hasCompleted or hasProgress then local oku, ups = pcall(getups, fn) if oku and type(ups) == "table" then for i, u in pairs(ups) do if type(u) == "number" and u == u and u >= 0 and u < 50000 then local oks = pcall(setup, fn, i, 100000) if oks then patched = true end end end end end end end pcall(function() local effects = workspace:FindFirstChild("Effects") if not effects then return end for _, outline in ipairs(effects:GetChildren()) do if outline.Name and outline.Name:find("Outline") then for _, part in ipairs(outline:GetDescendants()) do if part:IsA("BasePart") then part:SetAttribute("Done", true) end end end end end) pcall(function() local remotes = ReplicatedStorage:FindFirstChild("Remotes") local remote = remotes and remotes:FindFirstChild("DALGONATEMPREMPTE") if remote then remote:FireServer({ Completed = true }) remote:FireServer({ Success = true }) end end) return patched end function MainModule.start_auto_dalgona() if MainModule.AutoDalgonaEnabled then return end if not MainModule.is_game_active or not MainModule.is_game_active("Dalgona") then end MainModule.AutoDalgonaEnabled = true blockNewCracks() local okPatch = false pcall(function() okPatch = forceDalgonaProgress100() end) local taskId = task.spawn(function() local n = 0 while MainModule.AutoDalgonaEnabled do pcall(forceDalgonaProgress100) pcall(killCracks) n += 1 if n >= 8 then break end task.wait(0.25) end while MainModule.AutoDalgonaEnabled do pcall(killCracks) task.wait(0.5) end end) table.insert(MainModule.AutoDalgonaTasks, taskId) PlayToggleSound() MainModule.notify("Auto Dalgona", okPatch and "Progress forced 100%" or "Tried force complete", 0.9) return true end function MainModule.stop_auto_dalgona() if not MainModule.AutoDalgonaEnabled then return end MainModule.AutoDalgonaEnabled = false for _, connection in ipairs(MainModule.AutoDalgonaConnections) do if connection and connection.Disconnect then pcall(function() connection:Disconnect() end) end end MainModule.AutoDalgonaConnections = {} for _, taskId in ipairs(MainModule.AutoDalgonaTasks) do pcall(function() task.cancel(taskId) end) end MainModule.AutoDalgonaTasks = {} PlayToggleSound() end function MainModule.toggle_auto_dalgona(enabled) if enabled then if MainModule.is_game_active and not MainModule.is_game_active("Dalgona") then HSXNotify("Auto Dalgona", "Wait for Dalgona!", 0.9) PlayErrorSound() if MainModule.ToggleRefs.AutoDalgona and MainModule.ToggleRefs.AutoDalgona.SetValue then pcall(function() MainModule.ToggleRefs.AutoDalgona:SetValue(false) end) end return false end return MainModule.start_auto_dalgona() else MainModule.stop_auto_dalgona() return true end end --@encrypt_end MainModule.HideNicknameEnabled = false MainModule.HideAllNicknamesEnabled = false MainModule.HideNicknameConnection = nil MainModule.HideAllNicknamesConnection = nil local function getOwnNametag() local live = workspace:FindFirstChild("Live") if not live then return nil end local folder = live:FindFirstChild(LocalPlayer.Name) if not folder then return nil end local torso = folder:FindFirstChild("Torso") if not torso then return nil end return torso:FindFirstChild("Player_Nametag") end local function hideOwnNickname() local nametag = getOwnNametag() if nametag then pcall(function() nametag.Enabled = false if nametag:IsA("BillboardGui") or nametag:IsA("SurfaceGui") then nametag.Enabled = false end for _, child in ipairs(nametag:GetDescendants()) do if child:IsA("TextLabel") or child:IsA("TextButton") or child:IsA("ImageLabel") then child.Visible = false end end end) end end local function showOwnNickname() local nametag = getOwnNametag() if nametag then pcall(function() nametag.Enabled = true for _, child in ipairs(nametag:GetDescendants()) do if child:IsA("TextLabel") or child:IsA("TextButton") or child:IsA("ImageLabel") then child.Visible = true end end end) end end local function hideAllNicknames() local live = workspace:FindFirstChild("Live") if not live then return end for _, folder in ipairs(live:GetChildren()) do local torso = folder:FindFirstChild("Torso") if torso then local nametag = torso:FindFirstChild("Player_Nametag") if nametag then pcall(function() nametag.Enabled = false for _, child in ipairs(nametag:GetDescendants()) do if child:IsA("TextLabel") or child:IsA("TextButton") or child:IsA("ImageLabel") then child.Visible = false end end end) end end end end local function showAllNicknames() local live = workspace:FindFirstChild("Live") if not live then return end for _, folder in ipairs(live:GetChildren()) do local torso = folder:FindFirstChild("Torso") if torso then local nametag = torso:FindFirstChild("Player_Nametag") if nametag then pcall(function() nametag.Enabled = true for _, child in ipairs(nametag:GetDescendants()) do if child:IsA("TextLabel") or child:IsA("TextButton") or child:IsA("ImageLabel") then child.Visible = true end end end) end end end end function MainModule.toggle_hide_nickname(enabled) MainModule.HideNicknameEnabled = enabled if MainModule.HideNicknameConnection then MainModule.HideNicknameConnection:Disconnect() MainModule.HideNicknameConnection = nil end if enabled then hideOwnNickname() MainModule.HideNicknameConnection = RunService.Heartbeat:Connect(function() if MainModule.HideNicknameEnabled then hideOwnNickname() end end) else showOwnNickname() end PlayToggleSound() end function MainModule.toggle_hide_all_nicknames(enabled) MainModule.HideAllNicknamesEnabled = enabled if MainModule.HideAllNicknamesConnection then MainModule.HideAllNicknamesConnection:Disconnect() MainModule.HideAllNicknamesConnection = nil end if enabled then hideAllNicknames() MainModule.HideAllNicknamesConnection = RunService.Heartbeat:Connect(function() if MainModule.HideAllNicknamesEnabled then hideAllNicknames() end end) else showAllNicknames() end PlayToggleSound() end MainModule.CustomGravityEnabled = false MainModule.CustomGravityValue = 196.2 MainModule.CustomGravityConnection = nil MainModule.toggle_custom_gravity = function(enabled) MainModule.CustomGravityEnabled = enabled if MainModule.CustomGravityConnection then MainModule.CustomGravityConnection:Disconnect() MainModule.CustomGravityConnection = nil end if enabled then Workspace.Gravity = MainModule.CustomGravityValue MainModule.CustomGravityConnection = RunService.Heartbeat:Connect(function() if MainModule.CustomGravityEnabled then Workspace.Gravity = MainModule.CustomGravityValue end end) else Workspace.Gravity = 196.2 end PlayToggleSound() end MainModule.set_custom_gravity = function(value) local num = tonumber(value) if num and num >= 50 and num <= 500 then MainModule.CustomGravityValue = num if MainModule.CustomGravityEnabled then Workspace.Gravity = MainModule.CustomGravityValue end else MainModule.notify("Custom Gravity", "Invalid number (50-500)", 0.9) PlayErrorSound() end end MainModule.CustomJumpPowerEnabled = false MainModule.CustomJumpPowerValue = 50 MainModule.CustomJumpPowerConnection = nil MainModule.toggle_custom_jump_power = function(enabled) MainModule.CustomJumpPowerEnabled = enabled if MainModule.CustomJumpPowerConnection then MainModule.CustomJumpPowerConnection:Disconnect() MainModule.CustomJumpPowerConnection = nil end if enabled then local char = MainModule.get_character() if char then local hum = MainModule.get_humanoid(char) if hum then MainModule.OriginalJumpPower = hum.JumpPower hum.JumpPower = MainModule.CustomJumpPowerValue end end MainModule.CustomJumpPowerConnection = RunService.Heartbeat:Connect(function() if MainModule.CustomJumpPowerEnabled then local c = MainModule.get_character() if c then local h = MainModule.get_humanoid(c) if h and h.JumpPower ~= MainModule.CustomJumpPowerValue then h.JumpPower = MainModule.CustomJumpPowerValue end end end end) else local char = MainModule.get_character() if char then local hum = MainModule.get_humanoid(char) if hum then hum.JumpPower = MainModule.OriginalJumpPower or 50 end end end PlayToggleSound() end MainModule.set_custom_jump_power = function(value) local num = tonumber(value) if num and num >= 20 and num <= 200 then MainModule.CustomJumpPowerValue = num if MainModule.CustomJumpPowerEnabled then local char = MainModule.get_character() if char then local hum = MainModule.get_humanoid(char) if hum then hum.JumpPower = MainModule.CustomJumpPowerValue end end end else MainModule.notify("Custom Jump Power", "Invalid number (20-200)", 0.9) PlayErrorSound() end end MainModule.CustomGravityEnabled = false MainModule.CustomGravityValue = 196.2 MainModule.CustomGravityConnection = nil MainModule.toggle_custom_gravity = function(enabled) MainModule.CustomGravityEnabled = enabled if MainModule.CustomGravityConnection then MainModule.CustomGravityConnection:Disconnect() MainModule.CustomGravityConnection = nil end if enabled then Workspace.Gravity = MainModule.CustomGravityValue MainModule.CustomGravityConnection = RunService.Heartbeat:Connect(function() if MainModule.CustomGravityEnabled then Workspace.Gravity = MainModule.CustomGravityValue end end) else Workspace.Gravity = 196.2 end PlayToggleSound() end MainModule.set_custom_gravity = function(value) local num = tonumber(value) if num and num >= 50 and num <= 500 then MainModule.CustomGravityValue = num if MainModule.CustomGravityEnabled then Workspace.Gravity = MainModule.CustomGravityValue end else MainModule.notify("Custom Gravity", "Invalid number (50-500)", 0.9) PlayErrorSound() end end MainModule.CustomJumpPowerEnabled = false MainModule.CustomJumpPowerValue = 50 MainModule.CustomJumpPowerConnection = nil MainModule.toggle_custom_jump_power = function(enabled) MainModule.CustomJumpPowerEnabled = enabled if MainModule.CustomJumpPowerConnection then MainModule.CustomJumpPowerConnection:Disconnect() MainModule.CustomJumpPowerConnection = nil end if enabled then local char = MainModule.get_character() if char then local hum = MainModule.get_humanoid(char) if hum then MainModule.OriginalJumpPower = hum.JumpPower hum.JumpPower = MainModule.CustomJumpPowerValue end end MainModule.CustomJumpPowerConnection = RunService.Heartbeat:Connect(function() if MainModule.CustomJumpPowerEnabled then local c = MainModule.get_character() if c then local h = MainModule.get_humanoid(c) if h and h.JumpPower ~= MainModule.CustomJumpPowerValue then h.JumpPower = MainModule.CustomJumpPowerValue end end end end) else local char = MainModule.get_character() if char then local hum = MainModule.get_humanoid(char) if hum then hum.JumpPower = MainModule.OriginalJumpPower or 50 end end end PlayToggleSound() end MainModule.set_custom_jump_power = function(value) MainModule.CustomJumpPowerValue = value if MainModule.CustomJumpPowerEnabled then local char = MainModule.get_character() if char then local hum = MainModule.get_humanoid(char) if hum then hum.JumpPower = MainModule.CustomJumpPowerValue end end end end MainModule.CustomWinEnabled = false MainModule.CustomWinValue = 67 MainModule.CustomWinConnection = nil MainModule.toggle_custom_win = function(enabled) MainModule.CustomWinEnabled = enabled if MainModule.CustomWinConnection then MainModule.CustomWinConnection:Disconnect() MainModule.CustomWinConnection = nil end if enabled then LocalPlayer:SetAttribute("_GameWins", MainModule.CustomWinValue) MainModule.CustomWinConnection = RunService.Heartbeat:Connect(function() if MainModule.CustomWinEnabled then LocalPlayer:SetAttribute("_GameWins", MainModule.CustomWinValue) end end) end PlayToggleSound() end MainModule.set_custom_win = function(value) local num = tonumber(value) if num and num >= 0 and num <= 999999 then MainModule.CustomWinValue = math.floor(num) if MainModule.CustomWinEnabled then LocalPlayer:SetAttribute("_GameWins", MainModule.CustomWinValue) end else MainModule.notify("Custom Win", "Invalid number", 0.9) end end MainModule.AutoVoteEnabled = false MainModule.AutoVoteConnection = nil MainModule.VoteOption = "KeepPlaying" MainModule.toggle_auto_vote = function(enabled) MainModule.AutoVoteEnabled = enabled if MainModule.AutoVoteConnection then MainModule.AutoVoteConnection:Disconnect() MainModule.AutoVoteConnection = nil end if enabled then MainModule.AutoVoteConnection = RunService.Heartbeat:Connect(function() if MainModule.AutoVoteEnabled then pcall(function() local remotes = ReplicatedStorage:FindFirstChild("Remotes") if remotes then local voteRemote = remotes:FindFirstChild("ExtraTemporaryRemote") if voteRemote then voteRemote:FireServer({ Voting = MainModule.VoteOption }) end end end) end end) end PlayToggleSound() end MainModule.set_vote_option = function(option) MainModule.VoteOption = option end MainModule.NoCooldownProximityEnabled = false MainModule.ProximityConnection = nil MainModule.toggle_no_cooldown_proximity = function(enabled) MainModule.NoCooldownProximityEnabled = enabled local function setProximityCooldown(instance) if instance:IsA("ProximityPrompt") then instance.HoldDuration = 0 end end if enabled then for _, descendant in pairs(workspace:GetDescendants()) do setProximityCooldown(descendant) end MainModule.ProximityConnection = workspace.DescendantAdded:Connect(function(descendant) if MainModule.NoCooldownProximityEnabled then setProximityCooldown(descendant) end end) else if MainModule.ProximityConnection then MainModule.ProximityConnection:Disconnect() MainModule.ProximityConnection = nil end end PlayToggleSound() end MainModule.InfiniteJumpEnabled = false MainModule.InfiniteJumpConnection = nil MainModule.toggle_infinite_jump = function(enabled) MainModule.InfiniteJumpEnabled = enabled if MainModule.InfiniteJumpConnection then MainModule.InfiniteJumpConnection:Disconnect() MainModule.InfiniteJumpConnection = nil end if enabled then MainModule.InfiniteJumpConnection = UserInputService.JumpRequest:Connect(function() if MainModule.InfiniteJumpEnabled and LocalPlayer.Character and LocalPlayer.Character:FindFirstChild("Humanoid") then LocalPlayer.Character.Humanoid:ChangeState(Enum.HumanoidStateType.Jumping) end end) end PlayToggleSound() end loadstring([[ function LPH_NO_VIRTUALIZE(f) return f end; ]])(); loadstring([[ function LPH_NO_VIRTUALIZE(f) return f end; ]])(); --@encrypt_start loadstring([[ function LPH_NO_VIRTUALIZE(f) return f end; ]])(); MainModule.dalgona_complete_shape = function() if MainModule.is_game_active and not MainModule.is_game_active("Dalgona") then MainModule.notify("Dalgona", "Wait for Dalgona!", 0.9) if PlayErrorSound then PlayErrorSound() end return false end local getupvalues = (debug and (debug.getupvalues or debug.get_upvalues)) or getupvalues local setupvalue = (debug and (debug.setupvalue or debug.setup_value)) or setupvalue local getconstants = (debug and (debug.getconstants or debug.get_constants)) or getconstants local function forceProgress100() if not getgc or not getupvalues or not setupvalue then return false end local patched = false local list = getgc() if type(list) ~= "table" then return false end for _, fn in ipairs(list) do if type(fn) == "function" then local consts = nil if getconstants then local ok, cs = pcall(getconstants, fn) if ok then consts = cs end end local useful = false if type(consts) == "table" then for _, c in pairs(consts) do if c == "Progress" or c == "Completed" then useful = true break end if type(c) == "string" and c:find("%%", 1, true) then useful = true break end end end if useful then local ok, ups = pcall(getupvalues, fn) if ok and type(ups) == "table" then for i, u in pairs(ups) do if type(u) == "number" and u == u and u >= 0 and u < 5000 then if pcall(setupvalue, fn, i, 100000) then patched = true end end end end end end end return patched end task.spawn(function() local ok = false for _ = 1, 10 do if forceProgress100() then ok = true end task.wait(0.15) end if ok then HSXNotify("Dalgona", "Dalgona Completed", 0.9) else HSXNotify("Dalgona", "Failed (no hooks?)", 0.9) end end) return true end --@encrypt_end MainModule.Rebel = { Enabled = false, Connection = nil, LastCheckTime = 0, LastKillTime = 0, CheckCooldown = 0.1, KillCooldown = 0.05 } MainModule.toggle_rebel = function(enabled) MainModule.Rebel.Enabled = enabled if MainModule.Rebel.Connection then MainModule.Rebel.Connection:Disconnect() MainModule.Rebel.Connection = nil end if enabled then MainModule.Rebel.Connection = RunService.Heartbeat:Connect(function() if not MainModule.Rebel.Enabled then return end local currentTime = tick() if currentTime - MainModule.Rebel.LastCheckTime < MainModule.Rebel.CheckCooldown then return end MainModule.Rebel.LastCheckTime = currentTime local enemyNames = {} if workspace:FindFirstChild("Live") then for _, enemy in pairs(workspace.Live:GetChildren()) do if enemy:IsA("Model") and enemy:FindFirstChild("Enemy") and not enemy:FindFirstChild("Dead") then local isPlayer = false for _, player in pairs(game:GetService("Players"):GetPlayers()) do if player.Name == enemy.Name then isPlayer = true break end end if not isPlayer then table.insert(enemyNames, enemy.Name) end end end end if #enemyNames == 0 then return end for _, enemyName in pairs(enemyNames) do if currentTime - MainModule.Rebel.LastKillTime < MainModule.Rebel.KillCooldown then task.wait(MainModule.Rebel.KillCooldown - (currentTime - MainModule.Rebel.LastKillTime)) end local character = game:GetService("Players").LocalPlayer.Character local backpack = game:GetService("Players").LocalPlayer.Backpack local gun = nil if character then for _, tool in pairs(character:GetChildren()) do if tool:IsA("Tool") and tool:GetAttribute("Gun") then gun = tool break end end end if not gun and backpack then for _, tool in pairs(backpack:GetChildren()) do if tool:IsA("Tool") and tool:GetAttribute("Gun") then gun = tool break end end end if gun then local args = { gun, { ClientRayNormal = Vector3.new(-1.1920928955078125e-7, 1.0000001192092896, 0), FiredGun = true, SecondaryHitTargets = {}, ClientRayInstance = workspace:WaitForChild("StairWalkWay"):WaitForChild("Part"), ClientRayPosition = Vector3.new(-220.17489624023438, 183.2957763671875, 301.07257080078125), bulletCF = CFrame.new(-220.5039825439453, 185.22506713867188, 302.133544921875, 0.9551116228103638, 0.2567310333251953, -0.14782091975212097, 7.450581485102248e-9, 0.4989798665046692, 0.8666135668754578, 0.2962462604045868, -0.8277127146720886, 0.4765814542770386), HitTargets = { [enemyName] = "Head" }, bulletSizeC = Vector3.new(0.009999999776482582, 0.009999999776482582, 4.452499866485596), NoMuzzleFX = false, FirePosition = Vector3.new(-72.88850402832031, -679.4803466796875, -173.31005859375) } } pcall(function() game:GetService("ReplicatedStorage"):WaitForChild("Remotes"):WaitForChild("FiredGunClient"):FireServer(unpack(args)) end) MainModule.Rebel.LastKillTime = tick() task.wait(0.05) end end end) else MainModule.Rebel.LastKillTime = 0 MainModule.Rebel.LastCheckTime = 0 end PlayToggleSound() end MainModule.ParkourArtistEnabled = false MainModule.ParkourArtistConnection = nil MainModule.OriginalPower = nil MainModule.ParkourArtistState = nil MainModule.ParkourArtistConns = {} MainModule.unlock_parkour_artist = function() local replicatedStorage = game:GetService("ReplicatedStorage") local animations = replicatedStorage:FindFirstChild("Animations") local abilities = animations and animations:FindFirstChild("Abilities") local parkourArtist = abilities and abilities:FindFirstChild("ParkourArtist") if parkourArtist then if parkourArtist:IsA("BoolValue") then parkourArtist.Value = true elseif parkourArtist:IsA("NumberValue") or parkourArtist:IsA("IntValue") then parkourArtist.Value = 1 end for _, descendant in pairs(parkourArtist:GetDescendants()) do if descendant:IsA("BoolValue") then descendant.Value = true elseif descendant:IsA("NumberValue") or descendant:IsA("IntValue") then descendant.Value = 1 end end end LocalPlayer:SetAttribute("__OwnsParkourArtist", true) LocalPlayer:SetAttribute("HasParkourArtist", true) LocalPlayer:SetAttribute("UnlockedParkourArtist", true) end MainModule._ParkourCleanup = function() for _, c in ipairs(MainModule.ParkourArtistConns) do pcall(function() c:Disconnect() end) end MainModule.ParkourArtistConns = {} if MainModule.ParkourArtistConnection then pcall(function() MainModule.ParkourArtistConnection:Disconnect() end) MainModule.ParkourArtistConnection = nil end MainModule.ParkourArtistState = nil end MainModule._ParkourStartMechanics = function() MainModule._ParkourCleanup() local DOUBLE_JUMP_BOOST = 75 local DOUBLE_JUMP_SOUND = "rbxassetid://10753621125" local C_KEY = Enum.KeyCode.C local DASH_SPEED = 95 local DASH_DURATION = 0.28 local DASH_COOLDOWN = 0.65 local DASH_SLOWDOWN_TIME = 0.18 local Debris = game:GetService("Debris") local function getAnimFolder() local ok, result = pcall(function() return ReplicatedStorage:WaitForChild("Animations", 5) :WaitForChild("Abilities", 5) :WaitForChild("ParkourArtist", 5) end) if ok then return result end return nil end local function getAnimations() local folder = getAnimFolder() if not folder then return {} end local list = {} for _, obj in ipairs(folder:GetChildren()) do if obj:IsA("Animation") and obj.AnimationId ~= "" then table.insert(list, obj) end end return list end local EffectFolder = nil local function findEffectFolder() local names = { "PARKOURARTIST", "ParkourArtist", "PARKOUR_ARTIST", "Parkour", "PARKOUR", "ParkourArtistEffects", "ParkourEffects" } local paths = { function() return ReplicatedStorage.Effects.SetupParts.CustomEffectsFolders end, function() return ReplicatedStorage.Effects.Parts end, function() return ReplicatedStorage.Effects end, } for _, getParent in ipairs(paths) do local ok, parent = pcall(getParent) if ok and parent then for _, name in ipairs(names) do local folder = parent:FindFirstChild(name) if folder then return folder end end end end return nil end EffectFolder = findEffectFolder() local state = { JumpCount = 0, CanDoubleJump = false, HasLeftGround = false, DoubleJumpTrack = nil, CKeyTrack = nil, DoubleJumpAnim = nil, CKeyAnim = nil, DashCooldown = false, IsDashing = false, LastCPress = 0, } MainModule.ParkourArtistState = state local function getChar() return LocalPlayer.Character end local function getHumanoid() local c = getChar() return c and c:FindFirstChildOfClass("Humanoid") end local function getHRP() local c = getChar() return c and c:FindFirstChild("HumanoidRootPart") end local function getAnimator() local hum = getHumanoid() if not hum then return nil end local a = hum:FindFirstChildOfClass("Animator") if not a then a = Instance.new("Animator") a.Parent = hum end return a end local function assignAnimations() local anims = getAnimations() if #anims == 0 then HSXNotify("Parkour Artist", "No animations found", 1) return end if #anims == 1 then state.DoubleJumpAnim = anims[1] state.CKeyAnim = anims[1] else state.DoubleJumpAnim = anims[1] state.CKeyAnim = anims[2] end HSXNotify("Parkour Artist", "DoubleJump: " .. tostring(state.DoubleJumpAnim.Name) .. " | C: " .. tostring(state.CKeyAnim.Name), 1.2) end local function playAnim(anim, trackKey) if not anim then return nil end if state[trackKey] then pcall(function() state[trackKey]:Stop(0.08) state[trackKey]:Destroy() end) state[trackKey] = nil end local animator = getAnimator() if not animator then return nil end local ok, track = pcall(function() return animator:LoadAnimation(anim) end) if ok and track then state[trackKey] = track track.Priority = Enum.AnimationPriority.Action4 track.Looped = false pcall(function() track:Play(0.05, 1, 1) end) track.Stopped:Once(function() if state[trackKey] == track then pcall(function() track:Destroy() end) state[trackKey] = nil end end) return track end return nil end local function createFallbackEffect(hrp, isDash) local sound = Instance.new("Sound") sound.SoundId = isDash and "rbxassetid://9125411438" or DOUBLE_JUMP_SOUND sound.Volume = isDash and 0.9 or 1 sound.PlaybackSpeed = isDash and 1.15 or 1 sound.Parent = hrp sound:Play() Debris:AddItem(sound, 3) local att = Instance.new("Attachment") att.Parent = hrp local pe = Instance.new("ParticleEmitter") pe.Texture = "rbxassetid://241650934" pe.Rate = 0 pe.Lifetime = NumberRange.new(0.25, 0.45) pe.Speed = NumberRange.new(6, 14) pe.SpreadAngle = Vector2.new(40, 40) pe.Size = NumberSequence.new({ NumberSequenceKeypoint.new(0, 0.6), NumberSequenceKeypoint.new(1, 0) }) pe.Transparency = NumberSequence.new({ NumberSequenceKeypoint.new(0, 0.2), NumberSequenceKeypoint.new(1, 1) }) pe.Color = ColorSequence.new(Color3.fromRGB(180, 220, 255)) pe.LightEmission = 0.4 pe.Parent = att pe:Emit(isDash and 18 or 12) Debris:AddItem(att, 1.5) end local function playEffects(isDash) local char = getChar() local hrp = getHRP() if not char or not hrp then return end local playedSomething = false if EffectFolder then for _, obj in EffectFolder:GetDescendants() do if obj:IsA("Sound") then local snd = obj:Clone() snd.Parent = hrp snd:Play() snd.Ended:Once(function() if snd then snd:Destroy() end end) Debris:AddItem(snd, 8) playedSomething = true end end local bodyParts = {} for _, n in pairs({ "Head", "Torso", "UpperTorso", "LowerTorso", "Left Arm", "Right Arm", "Left Leg", "Right Leg", "LeftUpperArm", "RightUpperArm", "LeftLowerArm", "RightLowerArm", "LeftUpperLeg", "RightUpperLeg", "LeftLowerLeg", "RightLowerLeg", "LeftHand", "RightHand", "LeftFoot", "RightFoot", "HumanoidRootPart" }) do local pp = char:FindFirstChild(n) if pp and pp:IsA("BasePart") then table.insert(bodyParts, pp) end end for _, obj in EffectFolder:GetDescendants() do if obj:IsA("ParticleEmitter") then for _, limb in pairs(bodyParts) do local clone = obj:Clone() clone.Enabled = false clone.Parent = limb clone:Emit(clone:GetAttribute("EmitCount") or 8) Debris:AddItem(clone, 2.5) playedSomething = true end end end end if not playedSomething then createFallbackEffect(hrp, isDash) end end local function doDoubleJump() local hrp = getHRP() if not hrp then return end local cv = hrp.AssemblyLinearVelocity hrp.AssemblyLinearVelocity = Vector3.new(cv.X, DOUBLE_JUMP_BOOST, cv.Z) local sound = Instance.new("Sound") sound.SoundId = DOUBLE_JUMP_SOUND sound.Volume = 1 sound.PlaybackSpeed = 1 sound.Parent = hrp sound:Play() Debris:AddItem(sound, 3) playAnim(state.DoubleJumpAnim, "DoubleJumpTrack") playEffects(false) end local function doDash() if state.DashCooldown or state.IsDashing then return end if tick() - state.LastCPress < 0.28 then return end state.LastCPress = tick() local char = getChar() local hum = getHumanoid() local hrp = getHRP() if not char or not hum or not hrp then return end state.DashCooldown = true state.IsDashing = true local look = hrp.CFrame.LookVector local dir = Vector3.new(look.X, 0, look.Z) if dir.Magnitude < 0.05 then state.IsDashing = false task.delay(DASH_COOLDOWN, function() state.DashCooldown = false end) return end dir = dir.Unit playAnim(state.CKeyAnim, "CKeyTrack") playEffects(true) local startTime = tick() local conn conn = RunService.Heartbeat:Connect(function() if not MainModule.ParkourArtistEnabled then if conn then conn:Disconnect() end state.IsDashing = false return end if not hrp or not hrp.Parent then if conn then conn:Disconnect() end state.IsDashing = false return end local elapsed = tick() - startTime if elapsed >= DASH_DURATION + DASH_SLOWDOWN_TIME then if conn then conn:Disconnect() end state.IsDashing = false return end if elapsed < DASH_DURATION then local currentY = hrp.AssemblyLinearVelocity.Y hrp.AssemblyLinearVelocity = Vector3.new(dir.X * DASH_SPEED, currentY, dir.Z * DASH_SPEED) else local alpha = math.clamp((elapsed - DASH_DURATION) / DASH_SLOWDOWN_TIME, 0, 1) local speed = DASH_SPEED * (1 - alpha) local currentY = hrp.AssemblyLinearVelocity.Y hrp.AssemblyLinearVelocity = Vector3.new(dir.X * speed, currentY, dir.Z * speed) end local rayParams = RaycastParams.new() rayParams.FilterType = Enum.RaycastFilterType.Exclude rayParams.FilterDescendantsInstances = {char} rayParams.IgnoreWater = true local hit = workspace:Raycast(hrp.Position, dir * 3.5, rayParams) if hit then hrp.AssemblyLinearVelocity = Vector3.new(0, hrp.AssemblyLinearVelocity.Y, 0) if conn then conn:Disconnect() end state.IsDashing = false end end) table.insert(MainModule.ParkourArtistConns, conn) task.delay(DASH_COOLDOWN, function() state.DashCooldown = false end) end local function setupLandReset(character) local humanoid = character:WaitForChild("Humanoid", 5) if not humanoid then return end local c = humanoid.StateChanged:Connect(function(_, newState) if newState == Enum.HumanoidStateType.Landed or newState == Enum.HumanoidStateType.Running or newState == Enum.HumanoidStateType.RunningNoPhysics then state.JumpCount = 0 state.CanDoubleJump = false state.HasLeftGround = false end end) table.insert(MainModule.ParkourArtistConns, c) end local jumpConn = UserInputService.JumpRequest:Connect(function() if not MainModule.ParkourArtistEnabled then return end local humanoid = getHumanoid() local hrp = getHRP() if not humanoid or not hrp then return end local hstate = humanoid:GetState() if hstate == Enum.HumanoidStateType.Running or hstate == Enum.HumanoidStateType.RunningNoPhysics or hstate == Enum.HumanoidStateType.Landed or humanoid.FloorMaterial ~= Enum.Material.Air then state.JumpCount = 1 state.CanDoubleJump = false state.HasLeftGround = false task.spawn(function() local start = tick() while tick() - start < 0.35 do if not humanoid or not humanoid.Parent then return end if humanoid.FloorMaterial == Enum.Material.Air or humanoid:GetState() == Enum.HumanoidStateType.Jumping or humanoid:GetState() == Enum.HumanoidStateType.Freefall then state.HasLeftGround = true state.CanDoubleJump = true return end task.wait() end end) elseif state.CanDoubleJump and state.HasLeftGround and state.JumpCount == 1 and (hstate == Enum.HumanoidStateType.Freefall or hstate == Enum.HumanoidStateType.Jumping or humanoid.FloorMaterial == Enum.Material.Air) then state.JumpCount = 2 state.CanDoubleJump = false doDoubleJump() end end) table.insert(MainModule.ParkourArtistConns, jumpConn) local inputConn = UserInputService.InputBegan:Connect(function(input, processed) if processed then return end if not MainModule.ParkourArtistEnabled then return end if input.KeyCode == C_KEY then doDash() end end) table.insert(MainModule.ParkourArtistConns, inputConn) assignAnimations() if LocalPlayer.Character then setupLandReset(LocalPlayer.Character) end local charConn = LocalPlayer.CharacterAdded:Connect(function(char) state.JumpCount = 0 state.CanDoubleJump = false state.HasLeftGround = false state.DashCooldown = false state.IsDashing = false state.DoubleJumpTrack = nil state.CKeyTrack = nil task.wait(0.4) if MainModule.ParkourArtistEnabled then assignAnimations() setupLandReset(char) end end) table.insert(MainModule.ParkourArtistConns, charConn) end MainModule.toggle_parkour_artist = function(enabled) if enabled then if not MainModule.OriginalPower then MainModule.OriginalPower = LocalPlayer:GetAttribute("_EquippedPower") or "" end MainModule.unlock_parkour_artist() LocalPlayer:SetAttribute("_EquippedPower", "PARKOUR ARTIST") if MainModule.ParkourArtistConnection then MainModule.ParkourArtistConnection:Disconnect() end MainModule.ParkourArtistConnection = RunService.Heartbeat:Connect(function() if MainModule.ParkourArtistEnabled then LocalPlayer:SetAttribute("_EquippedPower", "PARKOUR ARTIST") LocalPlayer:SetAttribute("__OwnsParkourArtist", true) LocalPlayer:SetAttribute("HasParkourArtist", true) end end) MainModule.ParkourArtistEnabled = true MainModule._ParkourStartMechanics() else MainModule.ParkourArtistEnabled = false MainModule._ParkourCleanup() if MainModule.OriginalPower then LocalPlayer:SetAttribute("_EquippedPower", MainModule.OriginalPower) else LocalPlayer:SetAttribute("_EquippedPower", nil) end end PlayToggleSound() end MainModule.set_parkour_artist = function() MainModule.unlock_parkour_artist() PlayToggleSound() end MainModule.SpikesPlatformTeleport = { Enabled = false, Connection = nil, Platform = nil, OriginalCFrame = nil, SpikesPosition = nil } function MainModule.toggle_spikes_platform_teleport(enabled) if enabled and not MainModule.is_game_active("HideAndSeek") then MainModule.notify("Spikes Platform", "Wait for HideAndSeek", 0.9) PlayErrorSound() if MainModule.ToggleRefs.SpikesPlatformTeleport then MainModule.ToggleRefs.SpikesPlatformTeleport:SetValue(false) end return false end if MainModule.SpikesPlatformTeleport.Connection then MainModule.SpikesPlatformTeleport.Connection:Disconnect() MainModule.SpikesPlatformTeleport.Connection = nil end if MainModule.SpikesPlatformTeleport.Platform then pcall(function() MainModule.SpikesPlatformTeleport.Platform:Destroy() end) MainModule.SpikesPlatformTeleport.Platform = nil end MainModule.SpikesPlatformTeleport.Enabled = enabled MainModule.SpikesPlatformTeleport.OriginalCFrame = nil MainModule.SpikesPlatformTeleport.SpikesPosition = nil if not enabled then local character = MainModule.get_character() if character and MainModule.SpikesPlatformTeleport.OriginalCFrame then character:SetPrimaryPartCFrame(MainModule.SpikesPlatformTeleport.OriginalCFrame) HSXNotify({Title = "Spikes Platform", Description = "Returned", Duration = 0.9}) end PlayToggleSound() return true end local spikesPosition = nil local hideAndSeekMap = workspace:FindFirstChild("HideAndSeekMap") local killingParts = hideAndSeekMap and hideAndSeekMap:FindFirstChild("KillingParts") if killingParts then for _, spike in pairs(killingParts:GetChildren()) do if spike:IsA("BasePart") then spikesPosition = spike.Position break end end end if not spikesPosition then for _, spike in pairs(workspace:GetDescendants()) do if spike:IsA("BasePart") and spike.Name == "Spikes" then spikesPosition = spike.Position break end end end if not spikesPosition then MainModule.notify("TP To Spikes", "Spikes not found", 0.9) PlayErrorSound() if MainModule.ToggleRefs.SpikesPlatformTeleport then MainModule.ToggleRefs.SpikesPlatformTeleport:SetValue(false) end return false end MainModule.SpikesPlatformTeleport.SpikesPosition = spikesPosition local platform = Instance.new("Part") platform.Name = HttpService:GenerateGUID(false) platform.Size = Vector3.new(10, 1, 10) platform.Position = spikesPosition + Vector3.new(0, 10, 0) platform.Anchored = true platform.CanCollide = true platform.Transparency = 0.5 platform.Color = Color3.fromRGB(0, 255, 0) platform.Material = Enum.Material.Neon platform.Parent = workspace MainModule.SpikesPlatformTeleport.Platform = platform local character = MainModule.get_character() if character then local rootPart = MainModule.get_root_part(character) if rootPart then MainModule.SpikesPlatformTeleport.OriginalCFrame = character:GetPrimaryPartCFrame() local targetPosition = platform.Position + Vector3.new(0, 3, 0) rootPart.CFrame = CFrame.new(targetPosition) HSXNotify({Title = "Teleport to spikes", Description = "Teleported", Duration = 0.9}) end end MainModule.SpikesPlatformTeleport.Connection = RunService.Heartbeat:Connect(function() if not MainModule.SpikesPlatformTeleport.Enabled then return end if not MainModule.is_game_active("HideAndSeek") then MainModule.toggle_spikes_platform_teleport(false) if MainModule.ToggleRefs.SpikesPlatformTeleport then MainModule.ToggleRefs.SpikesPlatformTeleport:SetValue(false) end return end if not MainModule.SpikesPlatformTeleport.Platform or not MainModule.SpikesPlatformTeleport.Platform.Parent then local newPlatform = Instance.new("Part") newPlatform.Name = HttpService:GenerateGUID(false) newPlatform.Size = Vector3.new(10, 1, 10) newPlatform.Position = MainModule.SpikesPlatformTeleport.SpikesPosition + Vector3.new(0, 10, 0) newPlatform.Anchored = true newPlatform.CanCollide = true newPlatform.Transparency = 0.5 newPlatform.Color = Color3.fromRGB(0, 255, 0) newPlatform.Material = Enum.Material.Neon newPlatform.Parent = workspace MainModule.SpikesPlatformTeleport.Platform = newPlatform end local character = MainModule.get_character() if character then local rootPart = MainModule.get_root_part(character) if rootPart then local distance = (rootPart.Position - MainModule.SpikesPlatformTeleport.Platform.Position).Magnitude if distance > 15 then if not MainModule.SpikesPlatformTeleport.OriginalCFrame then MainModule.SpikesPlatformTeleport.OriginalCFrame = character:GetPrimaryPartCFrame() end local targetPosition = MainModule.SpikesPlatformTeleport.Platform.Position + Vector3.new(0, 3, 0) rootPart.CFrame = CFrame.new(targetPosition) end end end end) PlayToggleSound() return true end MainModule.HCGlassESPEnabled = false MainModule.HCGlassESPConnection = nil MainModule.HCGlassESPObjects = {} function MainModule.create_hc_glass_esp(tileModel, isBreakable) if MainModule.HCGlassESPObjects[tileModel] then return end local primaryPart = tileModel.PrimaryPart if not primaryPart then return end local highlight = Instance.new("Highlight") highlight.Adornee = tileModel highlight.DepthMode = Enum.HighlightDepthMode.AlwaysOnTop highlight.FillColor = isBreakable and Color3.fromRGB(255, 0, 0) or Color3.fromRGB(0, 255, 0) highlight.FillTransparency = 0.5 highlight.OutlineTransparency = 0.3 highlight.Parent = tileModel local billboard = Instance.new("BillboardGui") billboard.Adornee = primaryPart billboard.Size = UDim2.new(0, 100, 0, 30) billboard.StudsOffset = Vector3.new(0, 3, 0) billboard.AlwaysOnTop = true billboard.Parent = primaryPart local label = Instance.new("TextLabel") label.Size = UDim2.new(1, 0, 1, 0) label.BackgroundTransparency = 1 label.Text = isBreakable and "BREAKABLE" or "SAFE" label.TextColor3 = isBreakable and Color3.fromRGB(255, 0, 0) or Color3.fromRGB(0, 255, 0) label.TextScaled = true label.Font = Enum.Font.GothamBold label.TextStrokeTransparency = 0 label.TextStrokeColor3 = Color3.fromRGB(0, 0, 0) label.Parent = billboard MainModule.HCGlassESPObjects[tileModel] = { highlight = highlight, billboard = billboard, label = label, tile = tileModel } end function MainModule.scan_hc_glass_bridge() local glassHolder = workspace:FindFirstChild("GlassBridge") and workspace.GlassBridge:FindFirstChild("GlassHolder") if not glassHolder then return end for _, tilePair in pairs(glassHolder:GetChildren()) do for _, tileModel in pairs(tilePair:GetChildren()) do if tileModel:IsA("Model") and tileModel.PrimaryPart then local isBreakable = tileModel.PrimaryPart:GetAttribute("exploitingisevil") == true MainModule.create_hc_glass_esp(tileModel, isBreakable) end end end end function MainModule.clear_hc_glass_esp() for _, data in pairs(MainModule.HCGlassESPObjects) do if data.highlight then pcall(function() data.highlight:Destroy() end) end if data.billboard then pcall(function() data.billboard:Destroy() end) end end MainModule.HCGlassESPObjects = {} end function MainModule.toggle_hc_glass_esp(enabled) MainModule.HCGlassESPEnabled = enabled if MainModule.HCGlassESPConnection then MainModule.HCGlassESPConnection:Disconnect() MainModule.HCGlassESPConnection = nil end if enabled then MainModule.scan_hc_glass_bridge() MainModule.HCGlassESPConnection = RunService.Heartbeat:Connect(function() if not MainModule.HCGlassESPEnabled then return end if not MainModule.is_game_active("GlassBridge") then MainModule.disable_toggle("HCGlassESP") return end MainModule.scan_hc_glass_bridge() end) else MainModule.clear_hc_glass_esp() end PlayToggleSound() end MainModule.TugOfWarAutoQTEMiss = false MainModule.TugOfWarAutoQTEMissConnection = nil local function findTugOfWarCircle() local playerGui = LocalPlayer:FindFirstChild("PlayerGui") if not playerGui then return end local ui = playerGui:FindFirstChild("TugOfWarUIV2") or playerGui:FindFirstChild("TugOfWarUI") or playerGui:FindFirstChild("TugofWarRemake") if not ui then return end local remake = ui:FindFirstChild("TugofWarRemake") or ui local circle = remake and remake:FindFirstChild("CircleBase") if circle and circle.Visible then return circle end return nil end function MainModule.toggle_tug_of_war_auto_qte_miss(enabled) MainModule.TugOfWarAutoQTEMiss = enabled if MainModule.TugOfWarAutoQTEMissConnection then MainModule.TugOfWarAutoQTEMissConnection:Disconnect() MainModule.TugOfWarAutoQTEMissConnection = nil end if enabled then MainModule.TugOfWarAutoQTEMissConnection = RunService.RenderStepped:Connect(function() if not MainModule.TugOfWarAutoQTEMiss then return end if LocalPlayer:GetAttribute("TugOfWarPhase") ~= "QTE" then return end local circle = findTugOfWarCircle() if not circle then return end local arrow = circle:FindFirstChild("Arrow") local medium = circle:FindFirstChild("Medium") if not (arrow and medium) then return end medium.Rotation = arrow.Rotation end) else end PlayToggleSound() end loadstring([[ function LPH_NO_VIRTUALIZE(f) return f end; ]])(); loadstring([[ function LPH_NO_VIRTUALIZE(f) return f end; ]])(); --@encrypt_start loadstring([[ function LPH_NO_VIRTUALIZE(f) return f end; ]])(); MainModule.EffectShooter = { Enabled = false, Connection = nil, LastShootTime = 0, ShootCooldown = 0.05, TrackedPlayers = {}, TargetEffect = "GuardCanKillLockOn" } MainModule.get_local_gun = function() local gun = nil if LocalPlayer.Character then for _, tool in pairs(LocalPlayer.Character:GetChildren()) do if tool:IsA("Tool") and tool:GetAttribute("Gun") then gun = tool break end end end if not gun and LocalPlayer.Backpack then for _, tool in pairs(LocalPlayer.Backpack:GetChildren()) do if tool:IsA("Tool") and tool:GetAttribute("Gun") then gun = tool break end end end return gun end MainModule.has_target_effect = function(player) if not player or not player.Character then return false end for _, descendant in pairs(player.Character:GetDescendants()) do if descendant:IsA("BillboardGui") and descendant.Name == MainModule.EffectShooter.TargetEffect then return true end end return false end MainModule.shoot_at_player = function(targetPlayerName) local gun = MainModule.get_local_gun() if not gun then return false end local args = { gun, { ClientRayNormal = Vector3.new(-1.1920928955078125e-7, 1.0000001192092896, 0), FiredGun = true, SecondaryHitTargets = {}, ClientRayInstance = workspace:FindFirstChild("StairWalkWay") and workspace.StairWalkWay:FindFirstChild("Part") or nil, ClientRayPosition = Vector3.new(-220.17489624023438, 183.2957763671875, 301.07257080078125), bulletCF = CFrame.new(-220.5039825439453, 185.22506713867188, 302.133544921875, 0.9551116228103638, 0.2567310333251953, -0.14782091975212097, 7.450581485102248e-9, 0.4989798665046692, 0.8666135668754578, 0.2962462604045868, -0.8277127146720886, 0.4765814542770386), HitTargets = { [targetPlayerName] = "Head" }, bulletSizeC = Vector3.new(0.009999999776482582, 0.009999999776482582, 4.452499866485596), NoMuzzleFX = false, FirePosition = Vector3.new(-72.88850402832031, -679.4803466796875, -173.31005859375) } } pcall(function() ReplicatedStorage:WaitForChild("Remotes"):WaitForChild("FiredGunClient"):FireServer(unpack(args)) end) return true end MainModule.track_player_effects = function(player) if not player then return end if MainModule.EffectShooter.TrackedPlayers[player] then return end local connections = {} local characterAdded = player.CharacterAdded:Connect(function(character) task.wait(0.5) end) table.insert(connections, characterAdded) if player.Character then local descendantAdded = player.Character.DescendantAdded:Connect(function(descendant) end) table.insert(connections, descendantAdded) end MainModule.EffectShooter.TrackedPlayers[player] = connections end MainModule.toggle_effect_shooter = function(enabled) MainModule.EffectShooter.Enabled = enabled MainModule.AutoShootEnabled = enabled and true or false if MainModule.EffectShooter.Connection then MainModule.EffectShooter.Connection:Disconnect() MainModule.EffectShooter.Connection = nil end if enabled then pcall(function() if MainModule.toggle_rapid_fire and not MainModule.RapidFireEnabled then MainModule.toggle_rapid_fire(true) end end) pcall(function() if MainModule.toggle_infinite_ammo and not MainModule.InfiniteAmmoEnabled then MainModule.toggle_infinite_ammo(true) end end) local last = 0 MainModule.EffectShooter.Connection = RunService.Heartbeat:Connect(function() if not MainModule.EffectShooter.Enabled then return end local now = tick() if now - last < 0.08 then return end last = now local gun = MainModule.get_local_gun and MainModule.get_local_gun() if not gun then local char = LocalPlayer.Character if char then for _, t in ipairs(char:GetChildren()) do if t:IsA("Tool") and (t:GetAttribute("Gun") or t:FindFirstChild("GunScript") or string.lower(t.Name):find("gun")) then gun = t break end end end end if not gun then return end local hits = {} local live = workspace:FindFirstChild("Live") if live then for _, model in ipairs(live:GetChildren()) do if model:IsA("Model") and model.Name ~= LocalPlayer.Name then local player = Players:FindFirstChild(model.Name) local marked = false if player and MainModule.has_target_effect and MainModule.has_target_effect(player) then marked = true end if not marked then for _, d in ipairs(model:GetDescendants()) do if d:IsA("Highlight") and d.Enabled then local fc = d.FillColor if fc and fc.R > 0.7 and fc.G < 0.4 and fc.B < 0.4 then marked = true break end elseif d:IsA("BillboardGui") and (d.Name:find("Target") or d.Name:find("Effect")) then marked = true break end end end if marked then hits[model.Name] = "Head" end end end end for _, plr in ipairs(Players:GetPlayers()) do if plr ~= LocalPlayer and MainModule.has_target_effect and MainModule.has_target_effect(plr) then hits[plr.Name] = "Head" end end if next(hits) == nil then return end local remotes = ReplicatedStorage:FindFirstChild("Remotes") local remote = remotes and remotes:FindFirstChild("FiredGunClient") if not remote then return end local rayInst = workspace:FindFirstChild("StairWalkWay") and workspace.StairWalkWay:FindFirstChild("Part") or workspace local args = { gun, { ClientRayNormal = Vector3.new(0, 1, 0), FiredGun = true, SecondaryHitTargets = {}, ClientRayInstance = rayInst, ClientRayPosition = Vector3.new(0, 0, 0), bulletCF = CFrame.new(), HitTargets = hits, bulletSizeC = Vector3.new(0.01, 0.01, 5), NoMuzzleFX = true, FirePosition = Vector3.new(0, 0, 0) } } pcall(function() remote:FireServer(unpack(args)) end) end) end PlayToggleSound() end --@encrypt_end MainModule.is_mobile = function() return UserInputService.TouchEnabled and not UserInputService.KeyboardEnabled end MainModule.is_game_active = function(gameName) local values = Workspace:FindFirstChild("Values") if not values then return false end local currentGame = values:FindFirstChild("CurrentGame") return currentGame and currentGame.Value == gameName end MainModule.disable_toggle = function(toggleName) if MainModule.ToggleRefs[toggleName] and MainModule.ToggleRefs[toggleName].SetValue then pcall(function() MainModule.ToggleRefs[toggleName]:SetValue(false) end) end end MainModule.can_enable_toggle = function(gameName, toggleName, toggleRef) if not MainModule.is_game_active(gameName) then MainModule.notify(toggleName, "Wait for " .. gameName .. "!", 0.9) PlayErrorSound() if toggleRef and toggleRef.SetValue then pcall(function() toggleRef:SetValue(false) end) end return false end if not MainModule.is_feature_supported(toggleName) then MainModule.notify(toggleName, "Not supported in your executor", 0.9) PlayErrorSound() if toggleRef and toggleRef.SetValue then pcall(function() toggleRef:SetValue(false) end) end return false end return true end MainModule.safe_teleport = function(pos) local c = MainModule.get_character() if c then local rp = MainModule.get_root_part(c) if rp then rp.CFrame = CFrame.new(pos); return true end end return false end MainModule.SafeTeleport = MainModule.safe_teleport MainModule.is_hider = function(p) return p and p:GetAttribute("IsHider") == true end MainModule.is_seeker = function(p) return p and p:GetAttribute("IsHunter") == true end MainModule.FaceTargetModule = { Enabled = false, Connection = nil } MainModule.toggle_face_target = function(enabled) if type(enabled) ~= "boolean" then enabled = not MainModule.FaceTargetModule.Enabled end if MainModule.FaceTargetModule.Connection then MainModule.FaceTargetModule.Connection:Disconnect() MainModule.FaceTargetModule.Connection = nil end MainModule.FaceTargetModule.Enabled = enabled if enabled then MainModule.FaceTargetModule.Connection = RunService.Heartbeat:Connect(function() if not MainModule.FaceTargetModule.Enabled then return end local character = LocalPlayer.Character if not character then return end local root = character:FindFirstChild("HumanoidRootPart") if not root then return end local closestPlayer = nil local shortestDistance = math.huge local myPos = root.Position for _, player in ipairs(Players:GetPlayers()) do if player ~= LocalPlayer and player.Character then local targetRoot = player.Character:FindFirstChild("HumanoidRootPart") if targetRoot then local dist = (targetRoot.Position - myPos).Magnitude if dist < shortestDistance then shortestDistance = dist closestPlayer = player end end end end if closestPlayer and closestPlayer.Character then local targetRoot = closestPlayer.Character:FindFirstChild("HumanoidRootPart") if targetRoot then local lookAt = CFrame.lookAt(root.Position, targetRoot.Position) root.CFrame = CFrame.new(root.Position) * (lookAt - lookAt.Position) end end end) else end PlayToggleSound() end MainModule.AutoDodge = { Enabled = false, AnimationIds = { "rbxassetid://88451099342711", "rbxassetid://79649041083405", "rbxassetid://73242877658272", "rbxassetid://114928327045353", "rbxassetid://135690448001690", "rbxassetid://103355259844069", "rbxassetid://125906547773381", "rbxassetid://121147456137931", "rbxassetid://96924216250322", "rbxassetid://116839849594540", "rbxassetid://104041807075625", "rbxassetid://83057176809194", "rbxassetid://103318207627541", "rbxassetid://121473077508383", "rbxassetid://94215646393565", "rbxassetid://81533666958072", "rbxassetid://116839849594540" }, Connections = {}, LastDodgeTime = 0, DodgeCooldown = 1.1, Range = 6, RangeSquared = 36, AnimationIdsSet = {}, ActiveAnimations = {}, HeartbeatConnection = nil, PlayerStates = {}, PlayerLastPos = {}, PlayerAnimationStart = {}, DodgePredictions = {}, ActiveHitboxes = {}, LastLookVectors = {}, HitboxConnections = {}, } for _, id in ipairs(MainModule.AutoDodge.AnimationIds) do MainModule.AutoDodge.AnimationIdsSet[id] = true end MainModule.AutoDodge_executeDodgeInstant = function() if not MainModule.AutoDodge.Enabled then return false end local LocalPlayer = Players.LocalPlayer if not LocalPlayer then return false end local Backpack = LocalPlayer:FindFirstChild("Backpack") if not Backpack then return false end local dodgeItem = Backpack:FindFirstChild("DODGE!") if not dodgeItem then return false end local Hotbar = LocalPlayer.PlayerGui:FindFirstChild("Hotbar") if not Hotbar then return false end local HotbarFolder = Hotbar:FindFirstChild("Backpack") if not HotbarFolder then return false end local HotbarContainer = HotbarFolder:FindFirstChild("Hotbar") if not HotbarContainer then return false end local button = nil for _, slot in pairs(HotbarContainer:GetChildren()) do if slot:FindFirstChild("ToolName") and slot.ToolName.Text == "DODGE!" then button = slot break end end if not button then return false end local success = pcall(function() if not getconnections then return end local connections = getconnections(button.MouseButton1Down) for _, connection in pairs(connections) do connection:Fire() end end) if success then MainModule.AutoDodge.LastDodgeTime = tick() end return success end MainModule.AutoDodge_executeDodge = function() if not MainModule.AutoDodge.Enabled then return false end local currentTime = tick() if currentTime - MainModule.AutoDodge.LastDodgeTime < MainModule.AutoDodge.DodgeCooldown then return false end local LocalPlayer = Players.LocalPlayer if not LocalPlayer then return false end local Backpack = LocalPlayer:FindFirstChild("Backpack") if not Backpack then return false end local dodgeItem = Backpack:FindFirstChild("DODGE!") if not dodgeItem then return false end local Hotbar = LocalPlayer.PlayerGui:FindFirstChild("Hotbar") if not Hotbar then return false end local HotbarFolder = Hotbar:FindFirstChild("Backpack") if not HotbarFolder then return false end local HotbarContainer = HotbarFolder:FindFirstChild("Hotbar") if not HotbarContainer then return false end local button = nil for _, slot in pairs(HotbarContainer:GetChildren()) do if slot:FindFirstChild("ToolName") and slot.ToolName.Text == "DODGE!" then button = slot break end end if not button then return false end local success = pcall(function() if not getconnections then return end local connections = getconnections(button.MouseButton1Down) for _, connection in pairs(connections) do connection:Fire() end end) if not success then return false end MainModule.AutoDodge.LastDodgeTime = currentTime return true end function MainModule.AutoDodge_getForwardLength(animId, animationTrack) local baseLength = 5 local speedMultiplier = 0.88 if animId:find("99157505926076") or animId:find("123072675259257") then baseLength = 16 elseif animId:find("73242877658272") or animId:find("79649041083405") then baseLength = 6.5 end local specialAnimIds = {"773242877658272", "79649041083405", "105341857343164"} local isSpecialAnim = false for _, id in ipairs(specialAnimIds) do if animId:find(id) then isSpecialAnim = true break end end if isSpecialAnim and animationTrack and animationTrack.IsPlaying then local success, speed = pcall(function() return animationTrack.Speed end) if success and speed and speed >= 19 then speedMultiplier = 1.3 end end return baseLength * speedMultiplier end function MainModule.AutoDodge_getAnimationLength(animationTrack) local success, length = pcall(function() return animationTrack.Length end) return success and length or 1 end function MainModule.AutoDodge_setupHitboxUpdater(hitbox, attachTo, offset) local connection connection = RunService.RenderStepped:Connect(function() if not MainModule.AutoDodge.Enabled then if connection then connection:Disconnect() end return end if not hitbox or not hitbox.Parent then if connection then connection:Disconnect() end return end if not attachTo or not attachTo.Parent then if connection then connection:Disconnect() end return end hitbox.CFrame = attachTo.CFrame * offset end) return connection end MainModule.AutoDodge_createHitbox = function(character, animId, animationTrack, sourcePlayer) if not MainModule.AutoDodge.Enabled then return nil end local localPlayer = Players.LocalPlayer if sourcePlayer == localPlayer then return nil end if not character or not character.Parent then return nil end local humanoidRootPart = character:FindFirstChild("HumanoidRootPart") if not humanoidRootPart then return nil end local localChar = localPlayer and localPlayer.Character local localHRP = localChar and localChar:FindFirstChild("HumanoidRootPart") if not localHRP then return nil end if not animationTrack or not animationTrack.IsPlaying then return nil end local hitboxId = tostring(tick()) .. "*" .. tostring(character.Name) .. "*" .. string.sub(animId, -8) local animLength = MainModule.AutoDodge_getAnimationLength(animationTrack) local destroyTime = math.max(0.1, animLength - 0.1) local forwardLength = MainModule.AutoDodge_getForwardLength(animId, animationTrack) local frontHitbox = Instance.new("Part") frontHitbox.Name = "Hitbox_Front*" .. string.sub(animId, -6) .. "*" .. tick() frontHitbox.Size = Vector3.new(7.04, 5.28, forwardLength) frontHitbox.Color = Color3.fromRGB(255, 50, 50) frontHitbox.Transparency = 1 frontHitbox.Anchored = false frontHitbox.CanCollide = false frontHitbox.Material = Enum.Material.Neon local frontOffset = CFrame.new(0, 1.2, -(forwardLength / 2 + 1.5)) frontHitbox.CFrame = humanoidRootPart.CFrame * frontOffset local frontSelectionBox = Instance.new("SelectionBox") frontSelectionBox.Adornee = frontHitbox frontSelectionBox.Color3 = frontHitbox.Color frontSelectionBox.LineThickness = 0.12 frontSelectionBox.Transparency = 1 frontSelectionBox.Parent = frontHitbox frontHitbox.Parent = Workspace local backHitbox = Instance.new("Part") backHitbox.Name = "Hitbox_Back*" .. string.sub(animId, -6) .. "*" .. tick() backHitbox.Size = Vector3.new(0.7, 0.7, 0.7) backHitbox.Color = Color3.fromRGB(255, 200, 100) backHitbox.Transparency = 1 backHitbox.Material = Enum.Material.Neon backHitbox.Anchored = false backHitbox.CanCollide = false local backOffset = CFrame.new(0, 0.3, 1.5) backHitbox.CFrame = humanoidRootPart.CFrame * backOffset local backSelectionBox = Instance.new("SelectionBox") backSelectionBox.Adornee = backHitbox backSelectionBox.Color3 = backHitbox.Color backSelectionBox.LineThickness = 0.02 backSelectionBox.Transparency = 1 backSelectionBox.Parent = backHitbox backHitbox.Parent = Workspace local frontUpdateConnection = MainModule.AutoDodge_setupHitboxUpdater(frontHitbox, humanoidRootPart, frontOffset) local backUpdateConnection = MainModule.AutoDodge_setupHitboxUpdater(backHitbox, humanoidRootPart, backOffset) local hitboxData = { active = true, character = character, frontHitbox = frontHitbox, backHitbox = backHitbox, hitboxId = hitboxId, animationStartTime = tick(), hasDodged = false, animationTrack = animationTrack, characterName = character.Name } local function onTouch(otherPart) if not MainModule.AutoDodge.Enabled then return end if not localHRP or not localHRP.Parent then return end if hitboxData.hasDodged then return end if not hitboxData.active then return end local isOurBody = false if otherPart == localHRP then isOurBody = true elseif localChar and (otherPart.Parent == localChar or otherPart:IsDescendantOf(localChar)) then isOurBody = true end if isOurBody then hitboxData.hasDodged = true task.spawn(function() MainModule.AutoDodge_executeDodgeInstant() end) end end local frontTouchConn = frontHitbox.Touched:Connect(onTouch) local backTouchConn = backHitbox.Touched:Connect(onTouch) local function destroyHitboxes() hitboxData.active = false if frontUpdateConnection then frontUpdateConnection:Disconnect() end if backUpdateConnection then backUpdateConnection:Disconnect() end if frontTouchConn then frontTouchConn:Disconnect() end if backTouchConn then backTouchConn:Disconnect() end if frontHitbox and frontHitbox.Parent then frontHitbox:Destroy() end if backHitbox and backHitbox.Parent then backHitbox:Destroy() end end task.spawn(function() if destroyTime > 0 and destroyTime < animLength then task.wait(destroyTime) else while animationTrack and animationTrack.IsPlaying do task.wait(0.03) end end destroyHitboxes() end) return {frontHitbox, backHitbox} end function MainModule.AutoDodge_destroyAllHitboxes() for _, obj in pairs(Workspace:GetChildren()) do if obj:IsA("Part") and (obj.Name:find("Hitbox") or obj.Name:find("GiantHitbox") or obj.Name:find("RotationEffect")) then pcall(function() obj:Destroy() end) end end end function MainModule.AutoDodge_setupAnimationTrackingWithHitboxes() local function trackPlayer(player) if not player then return end local function onCharacterAdded(character) local humanoid = character:WaitForChild("Humanoid", 5) if not humanoid then return end humanoid.AnimationPlayed:Connect(function(animationTrack) if not MainModule.AutoDodge.Enabled then return end local animId = animationTrack.Animation.AnimationId if MainModule.AutoDodge.AnimationIdsSet[animId] then task.spawn(function() MainModule.AutoDodge_createHitbox(player.Character, animId, animationTrack, player) end) end end) end if player.Character then onCharacterAdded(player.Character) end player.CharacterAdded:Connect(onCharacterAdded) end for _, player in pairs(Players:GetPlayers()) do task.spawn(function() trackPlayer(player) end) end local pa = Players.PlayerAdded:Connect(function(player) trackPlayer(player) end) table.insert(MainModule.AutoDodge.Connections, pa) end MainModule.AutoDodge_predictAttack = function(player, localPlayer) if not player or not player.Character then return false end if not localPlayer or not localPlayer.Character then return false end local localRoot = localPlayer.Character:FindFirstChild("HumanoidRootPart") local targetRoot = player.Character:FindFirstChild("HumanoidRootPart") if not localRoot or not targetRoot then return false end local distance = (targetRoot.Position - localRoot.Position).Magnitude if distance > 6 then return false end local humanoid = player.Character:FindFirstChild("Humanoid") if not humanoid then return false end local hasAnim = false local animStarted = false local tracks = humanoid:GetPlayingAnimationTracks() for _, track in pairs(tracks) do if track and track.Animation and track.IsPlaying then local id = track.Animation.AnimationId if MainModule.AutoDodge.AnimationIdsSet[id] then hasAnim = true local startTime = MainModule.AutoDodge.PlayerAnimationStart[player.Name] or 0 if tick() - startTime < 0.3 then animStarted = true end break end end end if not hasAnim then return false end local lastPos = MainModule.AutoDodge.PlayerLastPos[player.Name] or targetRoot.Position local velocity = (targetRoot.Position - lastPos).Magnitude MainModule.AutoDodge.PlayerLastPos[player.Name] = targetRoot.Position local isMoving = velocity > 0.5 local state = MainModule.AutoDodge.PlayerStates[player.Name] or {} local lastDist = state.lastDist or distance local isClosing = distance < lastDist - 0.5 state.lastDist = distance MainModule.AutoDodge.PlayerStates[player.Name] = state local predictionKey = player.Name .. "_pred" local lastPred = MainModule.AutoDodge.DodgePredictions[predictionKey] or 0 if tick() - lastPred < 0.5 then return false end local shouldDodge = false if animStarted and (isMoving or isClosing) then shouldDodge = true end if animStarted and velocity > 3 then shouldDodge = true end if shouldDodge then MainModule.AutoDodge.DodgePredictions[predictionKey] = tick() return true end return false end MainModule.AutoDodge_processDodge = function() if not MainModule.AutoDodge.Enabled then return end local LocalPlayer = Players.LocalPlayer if not LocalPlayer or not LocalPlayer.Character then return end local localRoot = LocalPlayer.Character:FindFirstChild("HumanoidRootPart") if not localRoot then return end local players = Players:GetPlayers() for i = 1, #players do local player = players[i] if player == LocalPlayer then goto HSX_CONT_76 end if not player.Character then goto HSX_CONT_76 end local targetRoot = player.Character:FindFirstChild("HumanoidRootPart") if not targetRoot then goto HSX_CONT_76 end local distance = (targetRoot.Position - localRoot.Position).Magnitude if distance > 8 then MainModule.AutoDodge.PlayerStates[player.Name] = nil goto HSX_CONT_76 end local humanoid = player.Character:FindFirstChild("Humanoid") if not humanoid then goto HSX_CONT_76 end local hasAnim = false local tracks = humanoid:GetPlayingAnimationTracks() for _, track in pairs(tracks) do if track and track.Animation and track.IsPlaying then local id = track.Animation.AnimationId if MainModule.AutoDodge.AnimationIdsSet[id] then hasAnim = true if not MainModule.AutoDodge.PlayerAnimationStart[player.Name] then MainModule.AutoDodge.PlayerAnimationStart[player.Name] = tick() end break end end end if not hasAnim then MainModule.AutoDodge.PlayerAnimationStart[player.Name] = nil goto HSX_CONT_76 end if MainModule.AutoDodge_predictAttack(player, LocalPlayer) then local animKey = player.Name .. tostring(tick()) if not MainModule.AutoDodge.ActiveAnimations[player.Name] then MainModule.AutoDodge.ActiveAnimations[player.Name] = {} end if not MainModule.AutoDodge.ActiveAnimations[player.Name][animKey] then MainModule.AutoDodge.ActiveAnimations[player.Name][animKey] = true if MainModule.AutoDodge_executeDodge() then task.spawn(function() task.wait(0.3) if MainModule.AutoDodge.ActiveAnimations[player.Name] then MainModule.AutoDodge.ActiveAnimations[player.Name][animKey] = nil end end) else MainModule.AutoDodge.ActiveAnimations[player.Name][animKey] = nil end end end ::HSX_CONT_76:: end end MainModule._AutoUseSaved = MainModule._AutoUseSaved or {} MainModule.PushAutoUseTrue = function(key) key = tostring(key or "default") pcall(function() local autoUse = LocalPlayer:FindFirstChild("AutoUse") if not autoUse then autoUse = Instance.new("BoolValue") autoUse.Name = "AutoUse" autoUse.Parent = LocalPlayer end if MainModule._AutoUseSaved[key] == nil then MainModule._AutoUseSaved[key] = autoUse.Value end autoUse.Value = true end) end MainModule.PopAutoUse = function(key) key = tostring(key or "default") pcall(function() local autoUse = LocalPlayer:FindFirstChild("AutoUse") if not autoUse then return end local saved = MainModule._AutoUseSaved[key] if saved ~= nil then autoUse.Value = saved MainModule._AutoUseSaved[key] = nil end end) end MainModule.toggle_auto_dodge = function(enabled) local toggleRef = MainModule.ToggleRefs.AutoDodge if enabled then if MainModule.can_enable_toggle and not MainModule.can_enable_toggle("HideAndSeek", "Auto Dodge", toggleRef) then return false end end for _, conn in pairs(MainModule.AutoDodge.Connections) do if conn then pcall(function() conn:Disconnect() end) end end if MainModule.AutoDodge.HeartbeatConnection then pcall(function() MainModule.AutoDodge.HeartbeatConnection:Disconnect() end) MainModule.AutoDodge.HeartbeatConnection = nil end MainModule.AutoDodge.Enabled = false MainModule.AutoDodge.Connections = {} MainModule.AutoDodge.ActiveAnimations = {} MainModule.AutoDodge.LastDodgeTime = 0 MainModule.AutoDodge_destroyAllHitboxes() if enabled then MainModule.PushAutoUseTrue("AutoDodge") MainModule.AutoDodge.Enabled = true MainModule.AutoDodge_setupAnimationTrackingWithHitboxes() MainModule.AutoDodge.HeartbeatConnection = RunService.Heartbeat:Connect(function() MainModule.AutoDodge_processDodge() end) table.insert(MainModule.AutoDodge.Connections, MainModule.AutoDodge.HeartbeatConnection) else MainModule.PopAutoUse("AutoDodge") end PlayToggleSound() return true end MainModule.AutoUltraInstinct = { Enabled = false, ViewOwnHitboxes = false, AnimationIds = { "rbxassetid://88451099342711", "rbxassetid://79649041083405", "rbxassetid://73242877658272", "rbxassetid://114928327045353", "rbxassetid://135690448001690", "rbxassetid://103355259844069", "rbxassetid://125906547773381", "rbxassetid://121147456137931", "rbxassetid://96924216250322", "rbxassetid://116839849594540", "rbxassetid://104041807075625", "rbxassetid://83057176809194", "rbxassetid://103318207627541", "rbxassetid://121473077508383", "rbxassetid://94215646393565", "rbxassetid://81533666958052", "rbxassetid://116839849594540", "rbxassetid://85793691404836", "rbxassetid://86197206792061", "rbxassetid://87978085217719", "rbxassetid://85623602463927", "rbxassetid://103062305177426", "rbxassetid://99157505926076", "rbxassetid://114769224376981", "rbxassetid://9783204720378", "rbxassetid://94443309383954", "rbxassetid://98785078701251", "rbxassetid://123072675259257", "rbxassetid://85743982894847", "rbxassetid://89439896387299", "rbxassetid://97863204720378", "rbxassetid://106756593687295", "rbxassetid://81816623746576", "rbxassetid://81392013026663", "rbxassetid://109822392402606", "rbxassetid://134675465964672", "rbxassetid://137659772694747", "rbxassetid://85756694343517", "rbxassetid://131235569946744", "rbxassetid://76323709902827", "rbxassetid://73150160715773" }, Connections = {}, AnimationIdsSet = {}, DodgedHitboxes = {}, LastDodgeTime = 0, MinDodgeInterval = 0.02, LastLookVectors = {}, Active6663Hitbox = nil, IsDodging6663 = false, Dodge6663Count = 0, Max6663Dodges = 200, IsInside6663Hitbox = false, SpecialAnimations = { ["1123072675259257"] = true, ["99157505926076"] = true }, SpecialAnimationData = {}, SpecialDodgeRadius = 20, SpecialTrackRadius = 1500, IsInitialized = false, } for _, id in ipairs(MainModule.AutoUltraInstinct.AnimationIds) do MainModule.AutoUltraInstinct.AnimationIdsSet[id] = true end MainModule.AUI_cachedTool = nil MainModule.AUI_lastToolCheck = 0 MainModule.AUI_findUltraTool = function() local UI = MainModule.AutoUltraInstinct local currentTime = tick() if MainModule.AUI_cachedTool and currentTime - MainModule.AUI_lastToolCheck < 0.3 then return MainModule.AUI_cachedTool end local player = Players.LocalPlayer if not player then return nil end local character = player.Character if character then for _, tool in pairs(character:GetChildren()) do if tool:IsA("Tool") and tool.Name:lower():find("ultra") then MainModule.AUI_cachedTool = tool MainModule.AUI_lastToolCheck = currentTime return tool end end end local backpack = player:FindFirstChild("Backpack") if backpack then for _, tool in pairs(backpack:GetChildren()) do if tool:IsA("Tool") and tool.Name:lower():find("ultra") then MainModule.AUI_cachedTool = tool MainModule.AUI_lastToolCheck = currentTime return tool end end end MainModule.AUI_cachedTool = nil MainModule.AUI_lastToolCheck = currentTime return nil end MainModule.AUI_pressUltraHotbar = function() local ultraTool = MainModule.AUI_findUltraTool() if not ultraTool then return false end local toolName = ultraTool.Name local lp = Players.LocalPlayer if not lp then return false end local Hotbar = lp:FindFirstChild("PlayerGui") and lp.PlayerGui:FindFirstChild("Hotbar") if not Hotbar then return false end local hotbarContainer = Hotbar:FindFirstChild("Backpack") if not hotbarContainer then return false end local hotbar = hotbarContainer:FindFirstChild("Hotbar") if not hotbar then return false end local button = nil for _, slot in pairs(hotbar:GetChildren()) do local tn = slot:FindFirstChild("ToolName") if tn and tn.Text == toolName then button = slot break end end if not button then return false end if not getconnections then return false end local ok = pcall(function() for _, connection in pairs(getconnections(button.MouseButton1Down)) do pcall(function() connection:Fire() end) end task.wait(0.05) for _, connection in pairs(getconnections(button.MouseButton1Up)) do pcall(function() connection:Fire() end) end end) return ok end MainModule.AUI_isEnemyLookingAtUs = function(character, ourPosition, characterName) local UI = MainModule.AutoUltraInstinct local humanoidRootPart = character:FindFirstChild("HumanoidRootPart") if not humanoidRootPart then return false, 0, false end local enemyPosition = humanoidRootPart.Position local toOurPosition = (ourPosition - enemyPosition).Unit local enemyLookVector = humanoidRootPart.CFrame.LookVector local dotProduct = enemyLookVector:Dot(toOurPosition) local threshold = 0.05 local lastData = UI.LastLookVectors[characterName] local isSharpTurn = false if lastData then local lastVector = lastData.vector local angleChange = math.acos(math.clamp(enemyLookVector:Dot(lastVector), -1, 1)) if angleChange > 0.25 then isSharpTurn = true end end UI.LastLookVectors[characterName] = { vector = enemyLookVector, time = tick() } local isLooking = dotProduct > threshold or isSharpTurn return isLooking, dotProduct, isSharpTurn end MainModule.AUI_executeUltraNow = function(hitboxId, reason) local UI = MainModule.AutoUltraInstinct if not UI.Enabled then return false end local currentTime = tick() local is6663Hitbox = hitboxId and (string.find(hitboxId, "6663") or (UI.Active6663Hitbox and hitboxId == UI.Active6663Hitbox.hitboxId .. "_touch")) if is6663Hitbox then if not UI.IsInside6663Hitbox then return false end if not UI.Active6663Hitbox or not UI.Active6663Hitbox.active then return false end if UI.Dodge6663Count >= UI.Max6663Dodges then return false end else if currentTime - UI.LastDodgeTime < UI.MinDodgeInterval then return false end if UI.DodgedHitboxes[hitboxId] then return false end UI.DodgedHitboxes[hitboxId] = true end local success = MainModule.AUI_pressUltraHotbar() if success then if not is6663Hitbox then UI.LastDodgeTime = currentTime else UI.Dodge6663Count = UI.Dodge6663Count + 1 end end if not is6663Hitbox then task.spawn(function() task.wait(1.5) UI.DodgedHitboxes[hitboxId] = nil end) end return success end MainModule.AUI_startLimitedDodgeFor6663 = function(hitboxData) local UI = MainModule.AutoUltraInstinct if UI.IsDodging6663 then return end UI.IsDodging6663 = true UI.Active6663Hitbox = hitboxData UI.Dodge6663Count = 0 UI.IsInside6663Hitbox = true task.spawn(function() while UI.IsDodging6663 and hitboxData and hitboxData.active and UI.Dodge6663Count < UI.Max6663Dodges do if not UI.IsInside6663Hitbox then break end if not hitboxData.active or not hitboxData.frontHitbox or not hitboxData.frontHitbox.Parent then break end local success = MainModule.AUI_executeUltraNow(hitboxData.hitboxId .. "_touch", "6663 TOUCH DODGE") if not success then task.wait(0.01) else task.wait(0.03) end end UI.IsDodging6663 = false UI.Active6663Hitbox = nil UI.IsInside6663Hitbox = false end) end MainModule.AUI_setupHitboxUpdater = function(hitbox, attachTo, offset, isStatic) if isStatic then return nil end local connection connection = RunService.RenderStepped:Connect(function() if not MainModule.AutoUltraInstinct.Enabled then if connection then connection:Disconnect() end return end if not hitbox or not hitbox.Parent then if connection then connection:Disconnect() end return end if not attachTo or not attachTo.Parent then if connection then connection:Disconnect() end return end hitbox.CFrame = attachTo.CFrame * offset end) return connection end MainModule.AUI_getAnimationLength = function(animationTrack) local success, length = pcall(function() return animationTrack.Length end) return success and length or 1 end MainModule.AUI_getForwardLength = function(animId, isSpecial) if isSpecial then return 55 end local forwardLength = 5 if animId:find("99157505926076") or animId:find("123072675259257") then forwardLength = 16 elseif animId:find("73242877658272") or animId:find("79649041083405") then forwardLength = 6.5 end return forwardLength end MainModule.AUI_setupSpecialAnimationTracking = function(player, animId, animationTrack) local UI = MainModule.AutoUltraInstinct local animIdNumber = animId:match("(%d+)$") or animId:match("/(%d+)$") if not animIdNumber then return end if not UI.SpecialAnimations[animIdNumber] then return end local character = player.Character if not character then return end local humanoidRootPart = character:FindFirstChild("HumanoidRootPart") if not humanoidRootPart then return end local localPlayer = Players.LocalPlayer if player == localPlayer then return end local specialId = tostring(tick()) .. "_" .. tostring(player.Name) .. "_special_" .. animIdNumber local isActive = true local hasDodged = false local checkConnection = nil UI.SpecialAnimationData[specialId] = { active = true, character = character, humanoidRootPart = humanoidRootPart, player = player, animId = animIdNumber, hasDodged = false, startTime = tick(), isTracking = false } checkConnection = RunService.Heartbeat:Connect(function() if not UI.Enabled then if checkConnection then checkConnection:Disconnect() end return end if not isActive or hasDodged then if checkConnection then checkConnection:Disconnect() end return end local localChar = localPlayer.Character if not localChar then return end local localHRP = localChar:FindFirstChild("HumanoidRootPart") if not localHRP then return end if not character or not character.Parent or not humanoidRootPart or not humanoidRootPart.Parent then isActive = false if checkConnection then checkConnection:Disconnect() end return end local distance = (humanoidRootPart.Position - localHRP.Position).Magnitude if distance <= UI.SpecialDodgeRadius then if not hasDodged then hasDodged = true UI.SpecialAnimationData[specialId].hasDodged = true if checkConnection then checkConnection:Disconnect() end MainModule.AUI_executeUltraNow(specialId .. "_special_dodge", "SPECIAL ANIMATION DODGE") end end end) task.spawn(function() while isActive and animationTrack and animationTrack.IsPlaying do task.wait(0.03) end isActive = false if checkConnection then checkConnection:Disconnect() end UI.SpecialAnimationData[specialId] = nil end) end MainModule.AUI_createHitbox = function(character, animId, animationTrack, sourcePlayer) local UI = MainModule.AutoUltraInstinct if not UI.Enabled then return nil end local localPlayer = Players.LocalPlayer local animIdNumber = animId:match("(%d+)$") or animId:match("/(%d+)$") local isSpecialAnim = animIdNumber and UI.SpecialAnimations[animIdNumber] if isSpecialAnim and sourcePlayer ~= localPlayer then task.spawn(function() MainModule.AUI_setupSpecialAnimationTracking(sourcePlayer, animId, animationTrack) end) return nil end if sourcePlayer == localPlayer and not UI.ViewOwnHitboxes then return nil end if not character or not character.Parent then return nil end local humanoidRootPart = character:FindFirstChild("HumanoidRootPart") if not humanoidRootPart then return nil end local localChar = localPlayer and localPlayer.Character local localHRP = localChar and localChar:FindFirstChild("HumanoidRootPart") local startDistance = nil if localHRP and humanoidRootPart then startDistance = (humanoidRootPart.Position - localHRP.Position).Magnitude end task.wait(0.01) if not character or not character.Parent then return nil end if not humanoidRootPart or not humanoidRootPart.Parent then return nil end if not animationTrack or not animationTrack.IsPlaying then return nil end local isSpecial = animId:find("6663") ~= nil local hitboxId = tostring(tick()) .. "_" .. tostring(character.Name) .. "_" .. string.sub(animId, -8) local animLength = MainModule.AUI_getAnimationLength(animationTrack) local destroyTime if isSpecial then destroyTime = animLength + 3.1 else destroyTime = math.max(0.1, animLength - 0.1) end local staticPosition = nil local staticCFrame = nil if isSpecial then staticPosition = humanoidRootPart.Position staticCFrame = humanoidRootPart.CFrame end local forwardLength = MainModule.AUI_getForwardLength(animId, isSpecial) local frontHitbox = Instance.new("Part") if isSpecial then frontHitbox.Name = "GiantHitbox_6663_STATIC_" .. tick() frontHitbox.Size = Vector3.new(55, 32.5, 55) frontHitbox.Color = Color3.fromRGB(255, 0, 100) frontHitbox.Transparency = 0.35 frontHitbox.Anchored = true else frontHitbox.Name = "Hitbox_Front_" .. string.sub(animId, -6) .. "_" .. tick() frontHitbox.Size = Vector3.new(8, 6, forwardLength) frontHitbox.Color = Color3.fromRGB(255, 50, 50) frontHitbox.Transparency = 0.35 frontHitbox.Anchored = false end frontHitbox.CanCollide = false frontHitbox.Material = Enum.Material.Neon local frontOffset = CFrame.new(0, 1.2, -(forwardLength / 2 + 1.5)) if isSpecial then frontHitbox.CFrame = staticCFrame * frontOffset else frontHitbox.CFrame = humanoidRootPart.CFrame * frontOffset end local frontSelectionBox = Instance.new("SelectionBox") frontSelectionBox.Adornee = frontHitbox frontSelectionBox.Color3 = frontHitbox.Color frontSelectionBox.LineThickness = isSpecial and 0.35 or 0.12 frontSelectionBox.Transparency = 0.25 frontSelectionBox.Parent = frontHitbox local frontParticles = Instance.new("ParticleEmitter") frontParticles.Texture = "rbxasset://textures/particles/sparkles_main.dds" frontParticles.Color = ColorSequence.new(frontHitbox.Color) frontParticles.Size = NumberSequence.new(isSpecial and 4 or 0.4) frontParticles.Rate = isSpecial and 200 or 20 frontParticles.Lifetime = NumberRange.new(isSpecial and 1.5 or 0.25) frontParticles.SpreadAngle = Vector2.new(360, 360) frontParticles.VelocityInheritance = 0 frontParticles.Speed = NumberRange.new(isSpecial and 10 or 1.5) frontParticles.Parent = frontHitbox local hitboxData = { active = true, character = character, frontHitbox = frontHitbox, backHitbox = nil, hitboxId = hitboxId, animationStartTime = tick(), hasDodged = false, animationTrack = animationTrack, startDistance = startDistance, hasEnteredRadius = false, characterName = character.Name, turnWindowEndTime = tick() + 1.4, is6663 = isSpecial, staticPosition = staticPosition, staticCFrame = staticCFrame } if isSpecial then local pointLight = Instance.new("PointLight") pointLight.Color = Color3.fromRGB(255, 0, 100) pointLight.Range = 60 pointLight.Brightness = 4 pointLight.Parent = frontHitbox local attachment = Instance.new("Attachment") attachment.Parent = frontHitbox local smoke = Instance.new("Smoke") smoke.Color = Color3.fromRGB(255, 0, 100) smoke.Opacity = 0.5 smoke.RiseVelocity = 5 smoke.Size = 12 smoke.Parent = attachment local rotationEffect = Instance.new("Part") rotationEffect.Name = "RotationEffect" rotationEffect.Size = Vector3.new(60, 2, 60) rotationEffect.Shape = Enum.PartType.Cylinder rotationEffect.Color = Color3.fromRGB(255, 0, 100) rotationEffect.Transparency = 0.7 rotationEffect.Material = Enum.Material.Neon rotationEffect.Anchored = true rotationEffect.CanCollide = false rotationEffect.CFrame = staticCFrame rotationEffect.Parent = Workspace task.spawn(function() local startTime = tick() while hitboxData.active and rotationEffect and rotationEffect.Parent and UI.Enabled do local elapsed = tick() - startTime rotationEffect.CFrame = staticCFrame * CFrame.Angles(0, math.rad(elapsed * 180), 0) task.wait() end if rotationEffect then pcall(function() rotationEffect:Destroy() end) end end) end frontHitbox.Parent = Workspace local backHitbox = Instance.new("Part") backHitbox.Name = "Hitbox_Back_" .. string.sub(animId, -6) .. "_" .. tick() backHitbox.Size = Vector3.new(0.8, 0.8, 0.8) backHitbox.Color = Color3.fromRGB(255, 200, 100) backHitbox.Transparency = 0.15 backHitbox.Material = Enum.Material.Neon backHitbox.Anchored = isSpecial backHitbox.CanCollide = false local backOffset = CFrame.new(0, 0.3, 0.8) if isSpecial then backHitbox.CFrame = staticCFrame * backOffset else backHitbox.CFrame = humanoidRootPart.CFrame * backOffset end local backSelectionBox = Instance.new("SelectionBox") backSelectionBox.Adornee = backHitbox backSelectionBox.Color3 = Color3.fromRGB(255, 200, 100) backSelectionBox.LineThickness = 0.02 backSelectionBox.Transparency = 0.5 backSelectionBox.Parent = backHitbox backHitbox.Parent = Workspace hitboxData.backHitbox = backHitbox local frontUpdateConnection = MainModule.AUI_setupHitboxUpdater(frontHitbox, humanoidRootPart, frontOffset, isSpecial) local backUpdateConnection = MainModule.AUI_setupHitboxUpdater(backHitbox, humanoidRootPart, backOffset, isSpecial) local isOwnHitbox = (sourcePlayer == localPlayer) if isOwnHitbox then task.spawn(function() if isSpecial then while animationTrack and animationTrack.IsPlaying do task.wait(0.03) end task.wait(3.1) else if destroyTime > 0 and destroyTime < animLength then task.wait(destroyTime) else while animationTrack and animationTrack.IsPlaying do task.wait(0.03) end end end hitboxData.active = false if isSpecial then UI.IsDodging6663 = false UI.Active6663Hitbox = nil UI.IsInside6663Hitbox = false end if frontUpdateConnection then frontUpdateConnection:Disconnect() end if backUpdateConnection then backUpdateConnection:Disconnect() end if frontHitbox and frontHitbox.Parent then frontHitbox:Destroy() end if backHitbox and backHitbox.Parent then backHitbox:Destroy() end end) return {frontHitbox, backHitbox} end local turnCheckConnection = nil if not isSpecial then turnCheckConnection = RunService.RenderStepped:Connect(function() if not UI.Enabled then if turnCheckConnection then turnCheckConnection:Disconnect() end return end if hitboxData.hasDodged or not hitboxData.active then if turnCheckConnection then turnCheckConnection:Disconnect() end return end if tick() > hitboxData.turnWindowEndTime then if turnCheckConnection then turnCheckConnection:Disconnect() end return end if not localHRP or not localHRP.Parent then return end if not character or not character.Parent then return end local enemyHRP = character:FindFirstChild("HumanoidRootPart") if not enemyHRP then return end local currentDistance = (enemyHRP.Position - localHRP.Position).Magnitude local startDistanceCheck = hitboxData.startDistance and hitboxData.startDistance > 5.5 if startDistanceCheck and currentDistance <= 5.5 then if not hitboxData.hasEnteredRadius then hitboxData.hasEnteredRadius = true end local isLooking, _, isSharpTurn = MainModule.AUI_isEnemyLookingAtUs(character, localHRP.Position, hitboxData.characterName) if (isLooking or isSharpTurn) and hitboxData.hasEnteredRadius and hitboxData.active then hitboxData.hasDodged = true if turnCheckConnection then turnCheckConnection:Disconnect() end MainModule.AUI_executeUltraNow(hitboxId .. "_turn", "") end end end) end local function onTouch(otherPart, boxId) if not UI.Enabled then return end if not localHRP or not localHRP.Parent then return end local isOurBody = false if otherPart == localHRP then isOurBody = true elseif localChar and (otherPart.Parent == localChar or otherPart:IsDescendantOf(localChar)) then isOurBody = true end if isOurBody then if isSpecial then if not hitboxData.hasDodged and hitboxData.active then hitboxData.hasDodged = true UI.IsInside6663Hitbox = true MainModule.AUI_startLimitedDodgeFor6663(hitboxData) end else if not hitboxData.hasDodged then hitboxData.hasDodged = true if turnCheckConnection then turnCheckConnection:Disconnect() end MainModule.AUI_executeUltraNow(boxId, "") end end end end local function onTouchEnd(otherPart) if not UI.Enabled or not isSpecial or not hitboxData.active then return end local isOurBody = false if otherPart == localHRP then isOurBody = true elseif localChar and (otherPart.Parent == localChar or otherPart:IsDescendantOf(localChar)) then isOurBody = true end if isOurBody then UI.IsInside6663Hitbox = false end end local frontBoxId = hitboxId .. "_front" local backBoxId = hitboxId .. "_back" local frontTouchConn = frontHitbox.Touched:Connect(function(part) onTouch(part, frontBoxId) end) local backTouchConn = backHitbox.Touched:Connect(function(part) onTouch(part, backBoxId) end) local touchEndConn = nil if isSpecial then touchEndConn = frontHitbox.TouchEnded:Connect(function(part) onTouchEnd(part) end) end local function destroyHitboxes() hitboxData.active = false if isSpecial then UI.IsDodging6663 = false UI.Active6663Hitbox = nil UI.IsInside6663Hitbox = false end if frontUpdateConnection then frontUpdateConnection:Disconnect() end if backUpdateConnection then backUpdateConnection:Disconnect() end if turnCheckConnection then turnCheckConnection:Disconnect() end if frontTouchConn then frontTouchConn:Disconnect() end if backTouchConn then backTouchConn:Disconnect() end if touchEndConn then touchEndConn:Disconnect() end task.spawn(function() task.wait(2) UI.LastLookVectors[hitboxData.characterName] = nil end) task.spawn(function() task.wait(1.5) if not isSpecial then UI.DodgedHitboxes[frontBoxId] = nil UI.DodgedHitboxes[backBoxId] = nil UI.DodgedHitboxes[hitboxId .. "_turn"] = nil end end) if frontHitbox and frontHitbox.Parent then frontHitbox:Destroy() end if backHitbox and backHitbox.Parent then backHitbox:Destroy() end end task.spawn(function() if isSpecial then while animationTrack and animationTrack.IsPlaying do task.wait(0.03) end task.wait(3.1) else if destroyTime > 0 and destroyTime < animLength then task.wait(destroyTime) else while animationTrack and animationTrack.IsPlaying do task.wait(0.03) end end end destroyHitboxes() end) return {frontHitbox, backHitbox} end MainModule.AUI_destroyAllHitboxes = function() for _, obj in pairs(Workspace:GetChildren()) do if obj:IsA("Part") and (obj.Name:find("Hitbox") or obj.Name:find("GiantHitbox") or obj.Name:find("RotationEffect")) then pcall(function() obj:Destroy() end) end end end MainModule.AUI_setupAnimationTracking = function() local UI = MainModule.AutoUltraInstinct local function trackPlayer(player) if not player then return end local function onCharacterAdded(character) local humanoid = character:WaitForChild("Humanoid", 5) if not humanoid then return end local conn = humanoid.AnimationPlayed:Connect(function(animationTrack) if not UI.Enabled then return end local animId = animationTrack.Animation.AnimationId if UI.AnimationIdsSet[animId] then task.spawn(function() MainModule.AUI_createHitbox(player.Character, animId, animationTrack, player) end) end end) table.insert(UI.Connections, conn) end if player.Character then onCharacterAdded(player.Character) end local ca = player.CharacterAdded:Connect(onCharacterAdded) table.insert(UI.Connections, ca) end for _, player in pairs(Players:GetPlayers()) do task.spawn(function() trackPlayer(player) end) end local pa = Players.PlayerAdded:Connect(function(player) trackPlayer(player) end) table.insert(UI.Connections, pa) end MainModule.toggle_auto_ultra_instinct = function(enabled) local UI = MainModule.AutoUltraInstinct enabled = enabled and true or false UI.Enabled = enabled if enabled then MainModule.PushAutoUseTrue("AutoUltraInstinct") MainModule.AUI_destroyAllHitboxes() if not UI.IsInitialized then MainModule.AUI_setupAnimationTracking() task.spawn(function() while true do task.wait(5) local now = tick() for name, data in pairs(UI.LastLookVectors) do if now - data.time > 2 then UI.LastLookVectors[name] = nil end end end end) task.spawn(function() while true do task.wait(10) local now = tick() for id, data in pairs(UI.SpecialAnimationData) do if data.startTime and now - data.startTime > 10 then UI.SpecialAnimationData[id] = nil end end end end) UI.IsInitialized = true end else MainModule.AUI_destroyAllHitboxes() UI.IsDodging6663 = false UI.Active6663Hitbox = nil UI.Dodge6663Count = 0 UI.IsInside6663Hitbox = false UI.SpecialAnimationData = {} MainModule.PopAutoUse("AutoUltraInstinct") end PlayToggleSound() return true end MainModule.ThrowHelper = { Enabled = false, Connection = nil, LockedTarget = nil, IsLocked = false, CurrentTarget = nil, LastLookTarget = nil, CheckInterval = 0.5, LastCheckTime = 0, DotThreshold = 0.3 } MainModule.FaceTargetModule = MainModule.ThrowHelper MainModule.AutoThrow = { Enabled = false, LastThrowTime = 0, ThrowCooldown = 0.3, KeybindConnection = nil, TempFaceTask = nil, MobileButton = nil, IsThrowing = false, } MainModule.ThrowHelper_isLookingAtPlayer = function(targetPlayer, localPlayer) if not targetPlayer or not targetPlayer.Character then return false end if not localPlayer or not localPlayer.Character then return false end local targetHead = targetPlayer.Character:FindFirstChild("Head") local localHead = localPlayer.Character:FindFirstChild("Head") local localRoot = localPlayer.Character:FindFirstChild("HumanoidRootPart") if not (targetHead and localHead and localRoot) then return false end local directionToTarget = (targetHead.Position - localHead.Position).Unit local lookVector = localHead.CFrame.LookVector return directionToTarget:Dot(lookVector) > MainModule.ThrowHelper.DotThreshold end MainModule.ThrowHelper_findClosestPlayer = function() local character = LocalPlayer.Character if not character then return nil end local root = character:FindFirstChild("HumanoidRootPart") if not root then return nil end local closestPlayer, shortestDistance = nil, math.huge local myPos = root.Position for _, player in ipairs(Players:GetPlayers()) do if player ~= LocalPlayer and player.Character then local targetRoot = player.Character:FindFirstChild("HumanoidRootPart") if targetRoot then local dist = (targetRoot.Position - myPos).Magnitude if dist < shortestDistance then shortestDistance = dist closestPlayer = player end end end end return closestPlayer end MainModule.ThrowHelper_findPlayerLookingAt = function() local character = LocalPlayer.Character if not character then return nil end local root = character:FindFirstChild("HumanoidRootPart") if not root then return nil end local myPos = root.Position local lookingAt, closestDistance = nil, math.huge for _, player in ipairs(Players:GetPlayers()) do if player ~= LocalPlayer and player.Character then if MainModule.ThrowHelper_isLookingAtPlayer(player, LocalPlayer) then local targetRoot = player.Character:FindFirstChild("HumanoidRootPart") if targetRoot then local dist = (targetRoot.Position - myPos).Magnitude if dist < closestDistance then closestDistance = dist lookingAt = player end end end end end if lookingAt then return lookingAt end return MainModule.ThrowHelper_findClosestPlayer() end MainModule.ThrowHelper_selectTarget = function() local target = MainModule.ThrowHelper_findPlayerLookingAt() if target then MainModule.ThrowHelper.LockedTarget = target MainModule.ThrowHelper.IsLocked = true return true end return false end MainModule.ThrowHelper_resetTarget = function() MainModule.ThrowHelper.LockedTarget = nil MainModule.ThrowHelper.IsLocked = false MainModule.ThrowHelper.CurrentTarget = nil MainModule.ThrowHelper.LastLookTarget = nil end MainModule.ThrowHelper_toggleFaceTarget = function(enabled, lockTarget) if type(enabled) ~= "boolean" then enabled = not MainModule.ThrowHelper.Enabled end if MainModule.ThrowHelper.Connection then MainModule.ThrowHelper.Connection:Disconnect() MainModule.ThrowHelper.Connection = nil end MainModule.ThrowHelper.Enabled = enabled if enabled then if lockTarget then MainModule.ThrowHelper_selectTarget() end MainModule.ThrowHelper.Connection = RunService.Heartbeat:Connect(function() if not MainModule.ThrowHelper.Enabled then return end local character = LocalPlayer.Character if not character then return end local root = character:FindFirstChild("HumanoidRootPart") if not root then return end if MainModule.ThrowHelper.IsLocked and MainModule.ThrowHelper.LockedTarget then if MainModule.ThrowHelper.LockedTarget.Character and MainModule.ThrowHelper.LockedTarget.Character:FindFirstChild("HumanoidRootPart") then local targetRoot = MainModule.ThrowHelper.LockedTarget.Character:FindFirstChild("HumanoidRootPart") if targetRoot then local lookAt = CFrame.lookAt(root.Position, targetRoot.Position) root.CFrame = CFrame.new(root.Position) * (lookAt - lookAt.Position) end else MainModule.ThrowHelper_resetTarget() MainModule.ThrowHelper_selectTarget() end else local currentTime = tick() local target = nil if currentTime - MainModule.ThrowHelper.LastCheckTime >= MainModule.ThrowHelper.CheckInterval then MainModule.ThrowHelper.LastCheckTime = currentTime target = MainModule.ThrowHelper_findPlayerLookingAt() if target then MainModule.ThrowHelper.LastLookTarget = target MainModule.ThrowHelper.CurrentTarget = target else if MainModule.ThrowHelper.LastLookTarget and MainModule.ThrowHelper.LastLookTarget.Character then target = MainModule.ThrowHelper.LastLookTarget MainModule.ThrowHelper.CurrentTarget = target else target = MainModule.ThrowHelper_findClosestPlayer() MainModule.ThrowHelper.CurrentTarget = target MainModule.ThrowHelper.LastLookTarget = target end end end MainModule.ThrowHelper.CurrentTarget = MainModule.ThrowHelper.LastLookTarget if MainModule.ThrowHelper.CurrentTarget and MainModule.ThrowHelper.CurrentTarget.Character then local targetRoot = MainModule.ThrowHelper.CurrentTarget.Character:FindFirstChild("HumanoidRootPart") if targetRoot then local lookAt = CFrame.lookAt(root.Position, targetRoot.Position) root.CFrame = CFrame.new(root.Position) * (lookAt - lookAt.Position) end end end end) else MainModule.ThrowHelper_resetTarget() end end MainModule.AutoThrow_findThrowTool = function() if LocalPlayer.Backpack then for _, tool in pairs(LocalPlayer.Backpack:GetChildren()) do if tool:IsA("Tool") and string.find(tool.Name, "Throw") then return tool end end end if LocalPlayer.Character then for _, tool in pairs(LocalPlayer.Character:GetChildren()) do if tool:IsA("Tool") and string.find(tool.Name, "Throw") then return tool end end end return nil end MainModule.AutoThrow_executeThrow = function() if not MainModule.AutoThrow.Enabled then return false end local currentTime = tick() if currentTime - MainModule.AutoThrow.LastThrowTime < MainModule.AutoThrow.ThrowCooldown then return false end local throwTool = MainModule.AutoThrow_findThrowTool() if not throwTool then return false end local Hotbar = LocalPlayer.PlayerGui:FindFirstChild("Hotbar") if not Hotbar then return false end local hotbarContainer = Hotbar:FindFirstChild("Backpack") if not hotbarContainer then return false end local hotbar = hotbarContainer:FindFirstChild("Hotbar") if not hotbar then return false end local button = nil for _, slot in pairs(hotbar:GetChildren()) do if slot:FindFirstChild("ToolName") and slot.ToolName.Text == throwTool.Name then button = slot break end end if not button then return false end MainModule.AutoThrow.LastThrowTime = currentTime if not MainModule.ThrowHelper.Enabled then MainModule.ThrowHelper_toggleFaceTarget(true, true) else if not MainModule.ThrowHelper.IsLocked then MainModule.ThrowHelper_selectTarget() end end local success = pcall(function() for _, connection in pairs(getconnections(button.MouseButton1Down)) do connection:Fire() end task.wait(0.05) for _, connection in pairs(getconnections(button.MouseButton1Up)) do connection:Fire() end end) if success then if MainModule.AutoThrow.TempFaceTask then task.cancel(MainModule.AutoThrow.TempFaceTask) end MainModule.AutoThrow.TempFaceTask = task.delay(1.0, function() if MainModule.ThrowHelper.Enabled and MainModule.ThrowHelper.IsLocked then MainModule.ThrowHelper_resetTarget() task.delay(0.5, function() if MainModule.ThrowHelper.Enabled then MainModule.ThrowHelper_toggleFaceTarget(false) end end) end MainModule.AutoThrow.TempFaceTask = nil end) end return success end MainModule.AutoThrow_createMobileButton = function() if MainModule.AutoThrow.MobileButton then return end local pg = LocalPlayer:FindFirstChild("PlayerGui") if not pg then return end local gui = Instance.new("ScreenGui") gui.Name = "HSX_AutoThrowMobile" gui.ResetOnSpawn = false gui.ZIndexBehavior = Enum.ZIndexBehavior.Sibling gui.Parent = pg local btn = Instance.new("TextButton") btn.Name = "ThrowBtn" btn.Size = UDim2.fromOffset(100, 100) btn.Position = UDim2.new(1, -120, 1, -220) btn.AnchorPoint = Vector2.new(0, 0) btn.BackgroundColor3 = Color3.fromRGB(25, 25, 30) btn.BackgroundTransparency = 0.15 btn.TextColor3 = Color3.fromRGB(255, 255, 255) btn.Text = "THROW" btn.Font = Enum.Font.GothamBold btn.TextSize = 18 btn.AutoButtonColor = true btn.Parent = gui local corner = Instance.new("UICorner") corner.CornerRadius = UDim.new(1, 0) corner.Parent = btn local stroke = Instance.new("UIStroke") stroke.Color = Color3.fromRGB(255, 255, 255) stroke.Thickness = 1.5 stroke.Transparency = 0.5 stroke.Parent = btn btn.MouseButton1Click:Connect(function() MainModule.AutoThrow_executeThrow() end) btn.TouchTap:Connect(function() MainModule.AutoThrow_executeThrow() end) MainModule.AutoThrow.MobileButton = gui end MainModule.AutoThrow_destroyMobileButton = function() if MainModule.AutoThrow.MobileButton then pcall(function() MainModule.AutoThrow.MobileButton:Destroy() end) MainModule.AutoThrow.MobileButton = nil end end MainModule.toggle_auto_throw = function(enabled) MainModule.AutoThrow.Enabled = enabled and true or false if MainModule.AutoThrow.KeybindConnection then MainModule.AutoThrow.KeybindConnection:Disconnect() MainModule.AutoThrow.KeybindConnection = nil end MainModule.AutoThrow_destroyMobileButton() if enabled then pcall(function() MainModule.PushAutoUseTrue("AutoThrow") end) MainModule.AutoThrow.KeybindConnection = UserInputService.InputBegan:Connect(function(input, gameProcessed) if gameProcessed then return end if input.KeyCode == Enum.KeyCode.F then MainModule.AutoThrow_executeThrow() end end) -- mobile / touch button always available when enabled MainModule.AutoThrow_createMobileButton() else MainModule.ThrowHelper_resetTarget() if MainModule.ThrowHelper.Connection then MainModule.ThrowHelper.Connection:Disconnect() MainModule.ThrowHelper.Connection = nil end MainModule.ThrowHelper.Enabled = false pcall(function() MainModule.PopAutoUse("AutoThrow") end) end PlayToggleSound() return true end MainModule.Fly = {Enabled = false, Speed = 900, Connection = nil, BodyVelocity = nil} MainModule.toggle_fly = function(enabled, silent) if enabled then if MainModule.Fly.Enabled then return end MainModule.Fly.Enabled = true local c = MainModule.get_character() if not c then return end local h = MainModule.get_humanoid(c) local rp = MainModule.get_root_part(c) if not (h and rp) then return end h.UseJumpPower = false h.AutoRotate = false h.PlatformStand = true if MainModule.Fly.BodyVelocity then MainModule.Fly.BodyVelocity:Destroy() end local bv = Instance.new("BodyVelocity") bv.Name = "FlyBodyVelocity" bv.MaxForce = Vector3.new(40000, 40000, 40000) bv.Parent = rp MainModule.Fly.BodyVelocity = bv MainModule.Fly.Connection = RunService.Heartbeat:Connect(function() if not MainModule.Fly.Enabled or not c or not c.Parent then MainModule.toggle_fly(false, true) return end rp = MainModule.get_root_part(c) h = MainModule.get_humanoid(c) if not rp or not bv or not h then MainModule.toggle_fly(false, true) return end local cam = workspace.CurrentCamera if not cam then return end local camCF = cam.CFrame local forward = camCF.LookVector local right = camCF.RightVector local up = camCF.UpVector local keyPressed = false local moveDirection = Vector3.new(0,0,0) if UserInputService:IsKeyDown(Enum.KeyCode.W) then moveDirection = moveDirection + forward; keyPressed = true end if UserInputService:IsKeyDown(Enum.KeyCode.S) then moveDirection = moveDirection - forward; keyPressed = true end if UserInputService:IsKeyDown(Enum.KeyCode.A) then moveDirection = moveDirection - right; keyPressed = true end if UserInputService:IsKeyDown(Enum.KeyCode.D) then moveDirection = moveDirection + right; keyPressed = true end if UserInputService:IsKeyDown(Enum.KeyCode.Space) then moveDirection = moveDirection + up; keyPressed = true end if UserInputService:IsKeyDown(Enum.KeyCode.LeftControl) then moveDirection = moveDirection - up; keyPressed = true end if not keyPressed then local joyDir = h.MoveDirection if joyDir.Magnitude > 0.1 then moveDirection = (forward * joyDir.Z) + (right * joyDir.X) + (up * joyDir.Y) keyPressed = true end end if keyPressed and moveDirection.Magnitude > 0 then bv.Velocity = moveDirection.Unit * MainModule.Fly.Speed else bv.Velocity = Vector3.new(0,0,0) end end) if not silent then end else if not MainModule.Fly.Enabled then return end MainModule.Fly.Enabled = false if MainModule.Fly.Connection then MainModule.Fly.Connection:Disconnect(); MainModule.Fly.Connection = nil end if MainModule.Fly.BodyVelocity then MainModule.Fly.BodyVelocity:Destroy(); MainModule.Fly.BodyVelocity = nil end local c = MainModule.get_character() if c then local rp = MainModule.get_root_part(c) if rp then rp.AssemblyLinearVelocity = Vector3.new(0,0,0) end local h = MainModule.get_humanoid(c) if h then h.UseJumpPower = true h.AutoRotate = true h.PlatformStand = false end end if not silent then end end if not silent then PlayToggleSound() end end MainModule.set_fly_speed = function(speed) MainModule.Fly.Speed = speed end MainModule.harmfulEffectsList = {"RagdollStun","Stun","Stunned","StunEffect","StunHit","Knockback","Knockdown","Knockout","Dazed","Paralyzed","Freeze","Frozen","Sleep","Slow","Slowed","Root","Rooted", "Crawling", "Crawled"} MainModule.RemoveStunEnabled = false MainModule.toggle_remove_stun = function(enabled) MainModule.RemoveStunEnabled = enabled if enabled then local function remove() local c = MainModule.get_character() if not c then return end for _, e in ipairs(MainModule.harmfulEffectsList) do local eff = c:FindFirstChild(e) if eff then pcall(function() eff:Destroy() end) end end local h = MainModule.get_humanoid(c) if h and h:GetAttribute("Stunned") then h:SetAttribute("Stunned", false) end end remove() RunService.Heartbeat:Connect(function() if MainModule.RemoveStunEnabled then remove() end end) else end PlayToggleSound() end MainModule.SpeedHackEnabled = false MainModule.SpeedValue = 39 MainModule.SpeedHackLoop = nil MainModule.toggle_speed_hack = function(enabled) MainModule.SpeedHackEnabled = enabled if enabled then if MainModule.SpeedHackLoop then task.cancel(MainModule.SpeedHackLoop) end MainModule.SpeedHackLoop = task.spawn(function() while MainModule.SpeedHackEnabled do local c = MainModule.get_character() if c then local h = MainModule.get_humanoid(c) if h and h.Health > 0 then h.WalkSpeed = MainModule.SpeedValue end end task.wait(0.1) end end) else if MainModule.SpeedHackLoop then task.cancel(MainModule.SpeedHackLoop); MainModule.SpeedHackLoop = nil end local c = MainModule.get_character() if c then local h = MainModule.get_humanoid(c) if h then h.WalkSpeed = 16 end end end PlayToggleSound() end MainModule.set_speed_value = function(v) MainModule.SpeedValue = math.min(v, 50) if MainModule.SpeedHackEnabled then local c = MainModule.get_character() if c then local h = MainModule.get_humanoid(c) if h and h.Health > 0 then h.WalkSpeed = MainModule.SpeedValue end end end end MainModule.FOVEnabled = false MainModule.FOVValue = 120 MainModule.FOVConnection = nil MainModule.toggle_fov = function(enabled) if type(enabled) ~= "boolean" then enabled = not MainModule.FOVEnabled end MainModule.FOVEnabled = enabled local cam = workspace.CurrentCamera if enabled then cam.FieldOfView = MainModule.FOVValue if MainModule.FOVConnection then MainModule.FOVConnection:Disconnect() end MainModule.FOVConnection = cam:GetPropertyChangedSignal("FieldOfView"):Connect(function() if MainModule.FOVEnabled and cam.FieldOfView ~= MainModule.FOVValue then cam.FieldOfView = MainModule.FOVValue end end) else if MainModule.FOVConnection then MainModule.FOVConnection:Disconnect() MainModule.FOVConnection = nil end cam.FieldOfView = 70 end PlayToggleSound() end MainModule.set_fov = function(v) MainModule.FOVValue = math.min(v, 120) if MainModule.FOVEnabled then workspace.CurrentCamera.FieldOfView = MainModule.FOVValue end end MainModule.AutoQTEMode = "Legit" MainModule.AutoQTEEnabled = false MainModule.toggle_auto_qte = function(enabled) local toggleRef = MainModule.ToggleRefs.AutoQTE if enabled then if MainModule.is_xeno_executor() then MainModule.notify("Auto QTE", "Not supported in your executor", 0.9) PlayErrorSound() if toggleRef and toggleRef.SetValue then pcall(function() toggleRef:SetValue(false) end) end return false end end MainModule.AutoQTEEnabled = enabled if enabled then local ImpactFrames = LocalPlayer.PlayerGui:FindFirstChild("ImpactFrames") if ImpactFrames then local processed = {} ImpactFrames.ChildAdded:Connect(function(outer) if outer.Name ~= "OuterRingTemplate" or processed[outer] then return end processed[outer] = true task.defer(function() local inner = nil for _, g in pairs(ImpactFrames:GetChildren()) do if g.Name == "InnerTemplate" and g.Position == outer.Position and not g:GetAttribute("Failed") then inner = g; break end end if not inner or inner:GetAttribute("Tweening") or inner:GetAttribute("Failed") then return end local HBGQTE = require(ReplicatedStorage.Modules.HBGQTE) if MainModule.AutoQTEMode == "Legit" then pcall(function() HBGQTE.Pressed(false, {Inner=inner, Outer=outer, Duration=2, StartedAt=tick(), Data={}}) end) else pcall(function() HBGQTE.Pressed(true, {Inner=inner, Outer=outer, Duration=0.1, StartedAt=tick(), Data={}}) end) end end) end) end else end PlayToggleSound() return true end MainModule.set_auto_qte_mode = function(mode) MainModule.AutoQTEMode = mode end MainModule.teleport_up = function() local c = MainModule.get_character() if c then local rp = MainModule.get_root_part(c) if rp then rp.CFrame = rp.CFrame + Vector3.new(0,100,0); MainModule.notify("Teleport","Up 100",0.9) end end PlayBell() end MainModule.teleport_down = function() local c = MainModule.get_character() if c then local rp = MainModule.get_root_part(c) if rp then rp.CFrame = rp.CFrame + Vector3.new(0,-40,0); MainModule.notify("Teleport","Down 40",0.9) end end PlayBell() end MainModule.GamePassStates = { PermanentGuard = false, GlassVision = false, EmotePages = false, CustomPlayerTag = false, PrivateServerPlus = false, FreeVIP = false, Lighter = false } MainModule.toggle_permanent_guard = function(enabled) MainModule.GamePassStates.PermanentGuard = enabled LocalPlayer:SetAttribute("__OwnsPermGuard", enabled) PlayToggleSound() end MainModule.toggle_glass_vision = function(enabled) MainModule.GamePassStates = MainModule.GamePassStates or {} MainModule.GamePassStates.GlassVision = enabled and true or false MainModule.GlassVisionEnabled = enabled and true or false LocalPlayer:SetAttribute("__OwnsGlassManufacturerVision", enabled and true or false) PlayToggleSound() end MainModule.toggle_emote_pages = function(enabled) MainModule.GamePassStates.EmotePages = enabled LocalPlayer:SetAttribute("__OwnsEmotePages", enabled) PlayToggleSound() end MainModule.toggle_custom_player_tag = function(enabled) MainModule.GamePassStates.CustomPlayerTag = enabled LocalPlayer:SetAttribute("__OwnsCustomPlayerTag", enabled) PlayToggleSound() end MainModule.toggle_private_server_plus = function(enabled) MainModule.GamePassStates.PrivateServerPlus = enabled LocalPlayer:SetAttribute("__OwnsPSPlus", enabled) PlayToggleSound() end MainModule.unlock_vip = function() LocalPlayer:SetAttribute("__OwnsVIPGamepass", true) LocalPlayer:SetAttribute("__Owns2xVote", true) pcall(function() MainModule.GamePassStates.FreeVIP = true end) PlayBell() HSXNotify("VIP", "Unlocked", 0.9) end MainModule.toggle_lighter = function(enabled) MainModule.GamePassStates = MainModule.GamePassStates or {} MainModule.GamePassStates.Lighter = enabled and true or false MainModule.LighterEnabled = enabled and true or false LocalPlayer:SetAttribute("HasLighter", enabled and true or false) PlayToggleSound() end MainModule.LegitHitboxEnabled = false MainModule.LegitHitboxConn = nil MainModule.LegitHitboxParts = {} MainModule.legit_hitbox_enabled = false MainModule.legit_hitbox_conn = nil MainModule.legit_hitbox_parts = {} MainModule.toggle_legit_hitbox = function(enabled) MainModule.legit_hitbox_enabled = enabled and true or false if MainModule.legit_hitbox_conn then pcall(function() MainModule.legit_hitbox_conn:Disconnect() end) MainModule.legit_hitbox_conn = nil end for part, props in pairs(MainModule.legit_hitbox_parts) do if part and part.Parent then pcall(function() part.Size = props.Size part.CanCollide = props.CanCollide part.Transparency = props.Transparency end) end end MainModule.legit_hitbox_parts = {} if not enabled then PlayToggleSound() return true end local fixedSize = 8 MainModule.legit_hitbox_conn = RunService.Heartbeat:Connect(function() if not MainModule.legit_hitbox_enabled then return end local myChar = LocalPlayer.Character local myRoot = myChar and myChar:FindFirstChild("HumanoidRootPart") if not myRoot then return end local params = RaycastParams.new() params.FilterType = Enum.RaycastFilterType.Exclude params.FilterDescendantsInstances = { myChar } for _, p in pairs(Players:GetPlayers()) do if p ~= LocalPlayer and p.Character then local r = p.Character:FindFirstChild("HumanoidRootPart") if r then local dir = r.Position - myRoot.Position local dist = dir.Magnitude if dist < 0.1 then dist = 0.1 end local hit = workspace:Raycast(myRoot.Position, dir.Unit * math.min(dist, 400), params) local visible = (not hit) or (hit.Instance and hit.Instance:IsDescendantOf(p.Character)) if visible then if not MainModule.legit_hitbox_parts[r] then MainModule.legit_hitbox_parts[r] = { Size = r.Size, CanCollide = r.CanCollide, Transparency = r.Transparency } r.Size = Vector3.new(fixedSize, fixedSize, fixedSize) r.CanCollide = false r.Transparency = 0.45 end else local props = MainModule.legit_hitbox_parts[r] if props then r.Size = props.Size r.Transparency = props.Transparency r.CanCollide = props.CanCollide MainModule.legit_hitbox_parts[r] = nil end end end end end end) PlayToggleSound() return true end MainModule.InfiniteAmmoEnabled = false MainModule.OriginalAmmo = {} MainModule.toggle_infinite_ammo = function(enabled) MainModule.InfiniteAmmoEnabled = enabled if enabled then RunService.Heartbeat:Connect(function() if not MainModule.InfiniteAmmoEnabled then return end pcall(function() local c = MainModule.get_character() if c then for _, t in pairs(c:GetChildren()) do if t:IsA("Tool") then for _, o in pairs(t:GetDescendants()) do if (o:IsA("NumberValue") or o:IsA("IntValue")) and (o.Name:lower():find("ammo") or o.Name:lower():find("bullet")) then if not MainModule.OriginalAmmo[o] then MainModule.OriginalAmmo[o] = o.Value end; o.Value = math.huge end end end end end local bp = LocalPlayer:FindFirstChild("Backpack") if bp then for _, t in pairs(bp:GetChildren()) do if t:IsA("Tool") then for _, o in pairs(t:GetDescendants()) do if (o:IsA("NumberValue") or o:IsA("IntValue")) and (o.Name:lower():find("ammo") or o.Name:lower():find("bullet")) then if not MainModule.OriginalAmmo[o] then MainModule.OriginalAmmo[o] = o.Value end; o.Value = math.huge end end end end end end) end) else for o,v in pairs(MainModule.OriginalAmmo) do if o and o.Parent then o.Value = v end end MainModule.OriginalAmmo = {} end PlayToggleSound() end MainModule.set_custom_player_tag = function(tagNumber) local num = tonumber(tagNumber) if num and (0 <= num and num <= 999) then local formattedNum = string.format("%03d", num) local liveFolder = workspace:FindFirstChild("Live") if liveFolder then local playerFolder = liveFolder:FindFirstChild(LocalPlayer.Name) if playerFolder then local playerTags = playerFolder:FindFirstChild("PlayerTags") if playerTags then local backTag = playerTags:FindFirstChild("Back") local frontTag = playerTags:FindFirstChild("Front") local backLabel = nil local frontLabel = nil if backTag then local backSurface = backTag:FindFirstChild("SurfaceGui") if backSurface then backLabel = backSurface:FindFirstChild("TextLabel") end end if frontTag then local frontSurface = frontTag:FindFirstChild("SurfaceGui") if frontSurface then frontLabel = frontSurface:FindFirstChild("TextLabel") end end if backLabel and frontLabel then backLabel.Text = formattedNum frontLabel.Text = formattedNum end end end end end PlayBell() end MainModule.CustomPlayerTagEnabled = false MainModule.CustomPlayerTagValue = "067" MainModule.CustomPlayerTagConnection = nil local function FormatTagValue(value) local num = tonumber(value) if num and num >= 0 and num <= 999 then return string.format("%03d", num) end return "000" end MainModule.toggle_custom_player_tag = function(enabled) MainModule.CustomPlayerTagEnabled = enabled if MainModule.CustomPlayerTagConnection then MainModule.CustomPlayerTagConnection:Disconnect() MainModule.CustomPlayerTagConnection = nil end if enabled then MainModule.set_custom_player_tag(MainModule.CustomPlayerTagValue) MainModule.CustomPlayerTagConnection = RunService.Heartbeat:Connect(function() if MainModule.CustomPlayerTagEnabled then local liveFolder = workspace:FindFirstChild("Live") if liveFolder then local playerFolder = liveFolder:FindFirstChild(LocalPlayer.Name) if playerFolder then local playerTags = playerFolder:FindFirstChild("PlayerTags") if playerTags then local backTag = playerTags:FindFirstChild("Back") local frontTag = playerTags:FindFirstChild("Front") local backLabel = nil local frontLabel = nil if backTag then local backSurface = backTag:FindFirstChild("SurfaceGui") if backSurface then backLabel = backSurface:FindFirstChild("TextLabel") end end if frontTag then local frontSurface = frontTag:FindFirstChild("SurfaceGui") if frontSurface then frontLabel = frontSurface:FindFirstChild("TextLabel") end end if backLabel and frontLabel then local formattedValue = FormatTagValue(MainModule.CustomPlayerTagValue) if backLabel.Text ~= formattedValue then backLabel.Text = formattedValue end if frontLabel.Text ~= formattedValue then frontLabel.Text = formattedValue end end end end end end end) else MainModule.set_custom_player_tag(0) end PlayToggleSound() end MainModule.set_custom_tag_value = function(value) local formatted = FormatTagValue(value) MainModule.CustomPlayerTagValue = formatted if MainModule.CustomPlayerTagEnabled then MainModule.set_custom_player_tag(tonumber(formatted)) end end MainModule.AutoNextEnabled = false MainModule.AutoNextConn = nil MainModule.TargetPos = Vector3.new(-214.30,186.86,242.64) MainModule.Radius = 80 MainModule.toggle_auto_next_game = function(enabled) MainModule.AutoNextEnabled = enabled if MainModule.AutoNextConn then MainModule.AutoNextConn:Disconnect(); MainModule.AutoNextConn = nil end if enabled then local t = 0 MainModule.AutoNextConn = RunService.Heartbeat:Connect(function(dt) if not MainModule.AutoNextEnabled then return end local c = LocalPlayer.Character local pp = c and c.PrimaryPart and c.PrimaryPart.Position if pp and (pp - MainModule.TargetPos).Magnitude <= MainModule.Radius then t = t + dt if t >= 3.4 then t = 0; pcall(function() game:GetService("ReplicatedStorage"):WaitForChild("Remotes"):WaitForChild("TemporaryReachedBindable"):FireServer() end) end else t = 0 end end) else end PlayToggleSound() end local FreeDashEnabled = false local blockedRemotes = {"DashRequest"} function ToggleFreeDash(enabled) FreeDashEnabled = enabled MainModule.FreeDashEnabled = enabled if enabled then local b = LocalPlayer:FindFirstChild("Boosts") local fasterSprint = b and b:FindFirstChild("Faster Sprint") if not fasterSprint then MainModule.notify("Free Dash", "You don't have Faster Sprint boost!", 0.9) PlayErrorSound() return false end local currentLevel = fasterSprint.Value if currentLevel ~= 5 then MainModule.notify("Free Dash", "Your Faster Sprint level is " .. currentLevel .. ", need level 5!", 0.9) PlayErrorSound() return false end pcall(function() local r = ReplicatedStorage:FindFirstChild("Remotes") if r and setrawmetatable then for _, remoteName in ipairs(blockedRemotes) do local remote = r:FindFirstChild(remoteName) if remote then setrawmetatable(remote, {__index = function() return function() end end}) end end end if b and fasterSprint then fasterSprint.Value = 6 end end) PlayToggleSound() return true else pcall(function() local b = LocalPlayer:FindFirstChild("Boosts") if b and b:FindFirstChild("Faster Sprint") then local currentValue = b["Faster Sprint"].Value if currentValue == 6 then b["Faster Sprint"].Value = 5 end end end) PlayToggleSound() return true end end MainModule.toggle_free_dash = ToggleFreeDash MainModule.NoDashPhantomCDEnabled = false MainModule.NoDashPhantomCDConnection = nil MainModule.NoDashPhantomCDObj = nil function MainModule.toggle_no_dash_phantom_cd(enabled) MainModule.NoDashPhantomCDEnabled = enabled and true or false if MainModule.NoDashPhantomCDConnection then pcall(function() MainModule.NoDashPhantomCDConnection:Disconnect() end) MainModule.NoDashPhantomCDConnection = nil end MainModule.NoDashPhantomCDObj = nil if enabled then local targetObj = nil pcall(function() for _, obj in pairs(getgc(true)) do if type(obj) == "table" and rawget(obj, "CDDASHSTACKS") and rawget(obj, "StopCounter") then targetObj = obj break end end end) MainModule.NoDashPhantomCDObj = targetObj if targetObj then MainModule.NoDashPhantomCDConnection = RunService.RenderStepped:Connect(function() if not MainModule.NoDashPhantomCDEnabled then return end local obj = MainModule.NoDashPhantomCDObj if not obj then return end pcall(function() rawset(obj, "DashCD", nil) if rawget(obj, "CDDASHSTACKS") and rawget(obj, "CDDASHSTACKS") > 1 then rawset(obj, "CDDASHSTACKS", 1) end end) end) else MainModule.NoDashPhantomCDConnection = RunService.Heartbeat:Connect(function() if not MainModule.NoDashPhantomCDEnabled then return end if MainModule.NoDashPhantomCDObj then return end pcall(function() for _, obj in pairs(getgc(true)) do if type(obj) == "table" and rawget(obj, "CDDASHSTACKS") and rawget(obj, "StopCounter") then MainModule.NoDashPhantomCDObj = obj if MainModule.NoDashPhantomCDConnection then pcall(function() MainModule.NoDashPhantomCDConnection:Disconnect() end) end MainModule.NoDashPhantomCDConnection = RunService.RenderStepped:Connect(function() if not MainModule.NoDashPhantomCDEnabled then return end local o = MainModule.NoDashPhantomCDObj if not o then return end pcall(function() rawset(o, "DashCD", nil) if rawget(o, "CDDASHSTACKS") and rawget(o, "CDDASHSTACKS") > 1 then rawset(o, "CDDASHSTACKS", 1) end end) end) break end end end) end) end end PlayToggleSound() return true end MainModule.FasterSprintEnabled = false MainModule.FasterSprintLoop = nil _G.FasterSprintEnabled = false function MainModule.toggle_faster_sprint(enabled) enabled = enabled and true or false MainModule.FasterSprintEnabled = enabled _G.FasterSprintEnabled = enabled if MainModule.FasterSprintLoop then pcall(task.cancel, MainModule.FasterSprintLoop) MainModule.FasterSprintLoop = nil end if enabled then MainModule.FasterSprintLoop = task.spawn(function() local lp = LocalPlayer while MainModule.FasterSprintEnabled do local char = lp.Character if char and char.Parent then if not char:FindFirstChild("FASTERSPRINT") then local fasterSprintFolder = Instance.new("Folder") fasterSprintFolder.Name = "FASTERSPRINT" fasterSprintFolder.Parent = char end local lagFolder = char:FindFirstChild("DelIfGone_Folder") if lagFolder then lagFolder:Destroy() end local stamina = char:FindFirstChild("StaminaVal") if stamina then stamina.Value = 100 end local children = char:GetChildren() local target36 = children[36] if target36 and not char:FindFirstChild(target36.Name) then local targetFolder = Instance.new("Folder") targetFolder.Name = target36.Name targetFolder.Parent = char end end task.wait() end end) end PlayToggleSound() return true end MainModule.AmbienceEnabled = false MainModule.motionBlur = nil MainModule.blurAmount = 12 MainModule.blurAmplifier = 12 MainModule.lastVector = nil MainModule.originalTimeOfDay = nil MainModule.ambienceConnection = nil MainModule.timeFixConnection = nil MainModule.toggle_ambience = function(enabled) MainModule.AmbienceEnabled = enabled if enabled then local camera = workspace.CurrentCamera MainModule.lastVector = camera.CFrame.LookVector if MainModule.motionBlur and MainModule.motionBlur.Parent then MainModule.motionBlur:Destroy() end MainModule.motionBlur = Instance.new("BlurEffect", camera) local Lighting = game:GetService("Lighting") MainModule.originalTimeOfDay = Lighting.TimeOfDay Lighting.TimeOfDay = "22:00:00" if MainModule.timeFixConnection then MainModule.timeFixConnection:Disconnect() end MainModule.timeFixConnection = Lighting.Changed:Connect(function(property) if property == "TimeOfDay" and MainModule.AmbienceEnabled then Lighting.TimeOfDay = "22:00:00" end end) if MainModule.ambienceConnection then MainModule.ambienceConnection:Disconnect() end MainModule.ambienceConnection = RunService.Heartbeat:Connect(function() if not MainModule.AmbienceEnabled then return end local camera = workspace.CurrentCamera if not camera then return end if not MainModule.motionBlur or MainModule.motionBlur.Parent == nil then MainModule.motionBlur = Instance.new("BlurEffect", camera) end local currentVector = camera.CFrame.LookVector local magnitude = (currentVector - MainModule.lastVector).magnitude MainModule.motionBlur.Size = math.abs(magnitude) * MainModule.blurAmount * MainModule.blurAmplifier / 2 MainModule.lastVector = currentVector end) workspace.Changed:Connect(function(property) if property == "CurrentCamera" and MainModule.AmbienceEnabled then local camera = workspace.CurrentCamera if MainModule.motionBlur and MainModule.motionBlur.Parent then MainModule.motionBlur.Parent = camera else MainModule.motionBlur = Instance.new("BlurEffect", camera) end end end) else if MainModule.motionBlur then MainModule.motionBlur:Destroy() MainModule.motionBlur = nil end if MainModule.ambienceConnection then MainModule.ambienceConnection:Disconnect() MainModule.ambienceConnection = nil end if MainModule.timeFixConnection then MainModule.timeFixConnection:Disconnect() MainModule.timeFixConnection = nil end local Lighting = game:GetService("Lighting") if MainModule.originalTimeOfDay then Lighting.TimeOfDay = MainModule.originalTimeOfDay end end PlayToggleSound() end MainModule.ExitDoorESPEnabled = false MainModule.ExitDoorESPThread = nil MainModule.ExitDoorESPObjects = {} function MainModule.toggle_exit_door_esp(enabled) MainModule.ExitDoorESPEnabled = enabled if enabled then if MainModule.ExitDoorESPThread then task.cancel(MainModule.ExitDoorESPThread) end MainModule.ExitDoorESPThread = task.spawn(function() local espDoors = {} local function createDoorESP(model) local cf, size = model:GetBoundingBox() local box = Instance.new("BoxHandleAdornment") box.Adornee = model.PrimaryPart or model:FindFirstChildWhichIsA("BasePart") if not box.Adornee then return nil end box.Size = size box.Color3 = Color3.fromRGB(255, 255, 0) box.Transparency = 0.5 box.AlwaysOnTop = true box.ZIndex = 10 box.Parent = box.Adornee local billboard = Instance.new("BillboardGui") billboard.Adornee = box.Adornee billboard.Size = UDim2.new(0, 100, 0, 50) billboard.StudsOffset = Vector3.new(0, 3, 0) billboard.AlwaysOnTop = true billboard.Parent = box.Adornee local textLabel = Instance.new("TextLabel") textLabel.Size = UDim2.new(1, 0, 1, 0) textLabel.BackgroundTransparency = 1 textLabel.Text = "EXIT DOOR" textLabel.TextColor3 = Color3.fromRGB(255, 255, 0) textLabel.TextScaled = true textLabel.Font = Enum.Font.SourceSansBold textLabel.Parent = billboard return {box = box, billboard = billboard, part = box.Adornee} end while MainModule.ExitDoorESPEnabled do for _, obj in pairs(espDoors) do if obj.box and (not obj.part or not obj.part.Parent) then pcall(function() obj.box:Destroy() end) pcall(function() obj.billboard:Destroy() end) end end local hideMap = workspace:FindFirstChild("HideAndSeekMap") if hideMap then local function findDoors(parent) for _, child in pairs(parent:GetChildren()) do if child.Name == "EXITDOOR" and child:GetAttribute("ActuallyWorks") == true then if not espDoors[child] then local esp = createDoorESP(child) if esp then espDoors[child] = esp end end end findDoors(child) end end findDoors(hideMap) end task.wait(0.5) end end) else if MainModule.ExitDoorESPThread then task.cancel(MainModule.ExitDoorESPThread) MainModule.ExitDoorESPThread = nil end end PlayToggleSound() end MainModule.Misc = { ESPEnabled = false, ESPPlayers = true, ESPHiders = true, ESPSeekers = true, ESPNames = true, ESPDistance = true, ESPHighlight = true, ESPFillTransparency = 0.75, ESPOutlineTransparency = 0.2, ESPTextSize = 14 } MainModule.ESP = { Players = {}, Objects = {}, Connections = {}, Folder = nil, MainConnection = nil, UpdateRate = 0.1 } function MainModule.clear_player_esp(player) if not player then return end local espData = MainModule.ESP.Players[player] if espData then if espData.Highlight then espData.Highlight.Adornee = nil pcall(function() espData.Highlight:Destroy() end) end if espData.Billboard then pcall(function() espData.Billboard:Destroy() end) end if espData.CharAddedConn then pcall(function() espData.CharAddedConn:Disconnect() end) espData.CharAddedConn = nil end if espData.DiedConn then pcall(function() espData.DiedConn:Disconnect() end) espData.DiedConn = nil end MainModule.ESP.Players[player] = nil end end function MainModule.update_player_esp(player) if not player or player == LocalPlayer or not MainModule.Misc.ESPEnabled then return end local character = player.Character if not character then MainModule.clear_player_esp(player) return end local humanoid = character:FindFirstChildOfClass("Humanoid") local rootPart = character:FindFirstChild("HumanoidRootPart") if humanoid and rootPart and humanoid.Health > 0 then local espData = MainModule.ESP.Players[player] if not espData then espData = { Player = player, Highlight = nil, Billboard = nil, Label = nil, CharAddedConn = nil, DiedConn = nil } MainModule.ESP.Players[player] = espData espData.DiedConn = humanoid.Died:Connect(function() if espData.Highlight then espData.Highlight.Adornee = nil espData.Highlight.Enabled = false end if espData.Billboard then espData.Billboard.Enabled = false end end) end if not espData.Highlight then espData.Highlight = Instance.new("Highlight") espData.Highlight.Name = player.Name .. "_ESP" espData.Highlight.DepthMode = Enum.HighlightDepthMode.AlwaysOnTop espData.Highlight.Enabled = true espData.Highlight.Parent = MainModule.ESP.Folder or CoreGui end if espData.Highlight.Adornee ~= character then espData.Highlight.Adornee = character end local color = Color3.fromRGB(0, 120, 255) if MainModule.is_hider and MainModule.is_hider(player) then color = Color3.fromRGB(0, 255, 0) elseif MainModule.is_seeker and MainModule.is_seeker(player) then color = Color3.fromRGB(255, 0, 0) end espData.Highlight.FillColor = color espData.Highlight.OutlineColor = color espData.Highlight.FillTransparency = MainModule.Misc.ESPFillTransparency espData.Highlight.OutlineTransparency = MainModule.Misc.ESPOutlineTransparency espData.Highlight.Enabled = true if MainModule.Misc.ESPNames then if not espData.Billboard then espData.Billboard = Instance.new("BillboardGui") espData.Billboard.Name = player.Name .. "_Text" espData.Billboard.AlwaysOnTop = true espData.Billboard.Size = UDim2.new(0, 200, 0, 50) espData.Billboard.StudsOffset = Vector3.new(0, 2.5, 0) espData.Billboard.Parent = MainModule.ESP.Folder or CoreGui espData.Label = Instance.new("TextLabel") espData.Label.Size = UDim2.new(1, 0, 1, 0) espData.Label.BackgroundTransparency = 1 espData.Label.TextColor3 = color espData.Label.TextSize = 14 espData.Label.Font = Enum.Font.GothamBold espData.Label.TextStrokeColor3 = Color3.new(0, 0, 0) espData.Label.TextStrokeTransparency = 0.5 espData.Label.Parent = espData.Billboard end if espData.Billboard.Adornee ~= rootPart then espData.Billboard.Adornee = rootPart end espData.Billboard.Enabled = true local healthText = string.format("HP: %d/%d", math.floor(humanoid.Health), math.floor(humanoid.MaxHealth)) local nameText = player.DisplayName or player.Name espData.Label.Text = nameText .. "\n" .. healthText espData.Label.TextColor3 = color elseif espData.Billboard then espData.Billboard.Enabled = false end else local espData = MainModule.ESP.Players[player] if espData then if espData.Highlight then espData.Highlight.Enabled = false espData.Highlight.Adornee = nil end if espData.Billboard then espData.Billboard.Enabled = false espData.Billboard.Adornee = nil end end end end function MainModule.setup_player_esp(player) if player == LocalPlayer then return end MainModule.clear_player_esp(player) if player.Character then MainModule.update_player_esp(player) end local charAddedConn = player.CharacterAdded:Connect(function(character) task.wait(0.05) MainModule.update_player_esp(player) end) local espData = MainModule.ESP.Players[player] if espData then espData.CharAddedConn = charAddedConn end end --@encrypt_start function MainModule.toggle_old_esp(enabled) if Encrypt and Encrypt.start then pcall(Encrypt.start) end MainModule.Misc.ESPEnabled = enabled if MainModule.ESP.MainConnection then MainModule.ESP.MainConnection:Disconnect() MainModule.ESP.MainConnection = nil end MainModule.clear_esp() if enabled then MainModule.ESP.Folder = Instance.new("Folder") MainModule.ESP.Folder.Name = "HollyScriptX_ESP" MainModule.ESP.Folder.Parent = CoreGui for _, player in pairs(Players:GetPlayers()) do if player ~= LocalPlayer then MainModule.setup_player_esp(player) end end MainModule.ESP.Connections.PlayerAdded = Players.PlayerAdded:Connect(function(player) if MainModule.Misc.ESPEnabled then MainModule.setup_player_esp(player) end end) MainModule.ESP.Connections.PlayerRemoving = Players.PlayerRemoving:Connect(function(player) MainModule.clear_player_esp(player) end) MainModule.ESP.MainConnection = RunService.Heartbeat:Connect(function() if not MainModule.Misc.ESPEnabled then return end for player, espData in pairs(MainModule.ESP.Players) do if player and player.Parent then MainModule.update_player_esp(player) else MainModule.clear_player_esp(player) end end end) end PlayToggleSound() if Encrypt and Encrypt["end"] then pcall(Encrypt["end"]) end end --@encrypt_end function MainModule.clear_esp() for player, _ in pairs(MainModule.ESP.Players) do MainModule.clear_player_esp(player) end MainModule.ESP.Players = {} if MainModule.ESP.Connections then for name, connection in pairs(MainModule.ESP.Connections) do if connection then pcall(function() connection:Disconnect() end) MainModule.ESP.Connections[name] = nil end end end if MainModule.ESP.Folder then pcall(function() MainModule.ESP.Folder:Destroy() end) MainModule.ESP.Folder = nil end end local Players = game:GetService("Players") local RunService = game:GetService("RunService") local SoundService = game:GetService("SoundService") local CoreGui = game:GetService("CoreGui") local LocalPlayer = Players.LocalPlayer MainModule = MainModule or {} local function PlayToggleSound() local sound = Instance.new("Sound") sound.SoundId = "rbxassetid://99979147606311" sound.Volume = 5 sound.Parent = SoundService sound:Play() sound.Ended:Once(function() sound:Destroy() end) end local NewESP = { Enabled = false, RGB = false, Cache = {}, Connection = nil } local oldGui = CoreGui:FindFirstChild("NewESP") if oldGui then oldGui:Destroy() end NewESP.ScreenGui = Instance.new("ScreenGui") NewESP.ScreenGui.Name = "NewESP" NewESP.ScreenGui.ResetOnSpawn = false NewESP.ScreenGui.IgnoreGuiInset = true NewESP.ScreenGui.ZIndexBehavior = Enum.ZIndexBehavior.Sibling NewESP.ScreenGui.DisplayOrder = 999999 NewESP.ScreenGui.Parent = CoreGui local function GetRole(player, character) if not player or not character then return nil end local hunter = player:GetAttribute("Hunter") == true or player:GetAttribute("IsHunter") == true or character:GetAttribute("Hunter") == true or character:GetAttribute("IsHunter") == true local hider = player:GetAttribute("Hider") == true or player:GetAttribute("IsHider") == true or character:GetAttribute("Hider") == true or character:GetAttribute("IsHider") == true if hunter then return "Hunter" end if hider then return "Hider" end return nil end local function GetESPColor(player, character) local role = GetRole(player, character) if role == "Hunter" then return Color3.fromRGB(255, 65, 65) end if role == "Hider" then return Color3.fromRGB(65, 145, 255) end if NewESP.RGB then return Color3.fromHSV( (os.clock() * 0.35) % 1, 0.9, 1 ) end return Color3.fromRGB(235, 235, 240) end local function GetHealthColor(percent) if percent > 0.6 then return Color3.fromRGB(40, 240, 80) elseif percent > 0.3 then return Color3.fromRGB(255, 215, 40) end return Color3.fromRGB(255, 55, 55) end function NewESP.Hide(esp) if not esp then return end if esp.Box then esp.Box.Visible = false end if esp.Name then esp.Name.Visible = false end if esp.HealthText then esp.HealthText.Visible = false end if esp.HealthBg then esp.HealthBg.Visible = false end if esp.HealthBar then esp.HealthBar.Visible = false end end function NewESP.HideAll() for _, esp in pairs(NewESP.Cache) do NewESP.Hide(esp) end end function NewESP.DestroyESP(esp) if not esp then return end pcall(function() if esp.Box then esp.Box:Destroy() end if esp.Name then esp.Name:Destroy() end if esp.HealthText then esp.HealthText:Destroy() end if esp.HealthBg then esp.HealthBg:Destroy() end if esp.HealthBar then esp.HealthBar:Destroy() end end) end function NewESP.ClearAll() for _, esp in pairs(NewESP.Cache) do NewESP.DestroyESP(esp) end table.clear(NewESP.Cache) end function NewESP.Create(player) if NewESP.Cache[player] then return NewESP.Cache[player] end local esp = {} local box = Instance.new("Frame") box.Name = "Box" box.BackgroundTransparency = 1 box.BorderSizePixel = 0 box.Visible = false box.ZIndex = 10 box.Parent = NewESP.ScreenGui local boxStroke = Instance.new("UIStroke") boxStroke.Thickness = 1.5 boxStroke.Transparency = 0 boxStroke.Color = Color3.fromRGB(235, 235, 240) boxStroke.Parent = box local nameLabel = Instance.new("TextLabel") nameLabel.Name = "Name" nameLabel.BackgroundTransparency = 1 nameLabel.BorderSizePixel = 0 nameLabel.Font = Enum.Font.GothamBold nameLabel.TextSize = 13 nameLabel.TextColor3 = Color3.fromRGB(235, 235, 240) nameLabel.TextStrokeTransparency = 0.25 nameLabel.TextStrokeColor3 = Color3.new(0, 0, 0) nameLabel.TextXAlignment = Enum.TextXAlignment.Center nameLabel.Visible = false nameLabel.ZIndex = 11 nameLabel.Parent = NewESP.ScreenGui local healthText = Instance.new("TextLabel") healthText.Name = "Health" healthText.BackgroundTransparency = 1 healthText.BorderSizePixel = 0 healthText.Font = Enum.Font.Gotham healthText.TextSize = 11 healthText.TextColor3 = Color3.fromRGB(235, 235, 240) healthText.TextStrokeTransparency = 0.25 healthText.TextStrokeColor3 = Color3.new(0, 0, 0) healthText.TextXAlignment = Enum.TextXAlignment.Center healthText.Visible = false healthText.ZIndex = 11 healthText.Parent = NewESP.ScreenGui local healthBg = Instance.new("Frame") healthBg.Name = "HealthBackground" healthBg.BackgroundColor3 = Color3.fromRGB(10, 10, 10) healthBg.BorderSizePixel = 0 healthBg.Visible = false healthBg.ZIndex = 10 healthBg.Parent = NewESP.ScreenGui local healthBar = Instance.new("Frame") healthBar.Name = "HealthBar" healthBar.BackgroundColor3 = Color3.fromRGB(0, 255, 0) healthBar.BorderSizePixel = 0 healthBar.Visible = false healthBar.ZIndex = 11 healthBar.Parent = NewESP.ScreenGui esp.Box = box esp.BoxStroke = boxStroke esp.Name = nameLabel esp.HealthText = healthText esp.HealthBg = healthBg esp.HealthBar = healthBar NewESP.Cache[player] = esp return esp end local BoundingParts = { "Head", "HumanoidRootPart", "UpperTorso", "LowerTorso", "Torso", "LeftUpperArm", "LeftLowerArm", "LeftHand", "RightUpperArm", "RightLowerArm", "RightHand", "LeftUpperLeg", "LeftLowerLeg", "LeftFoot", "RightUpperLeg", "RightLowerLeg", "RightFoot", "Left Arm", "Right Arm", "Left Leg", "Right Leg" } local function GetScreenBounds(character, camera) local minX = math.huge local minY = math.huge local maxX = -math.huge local maxY = -math.huge local found = false for _, name in ipairs(BoundingParts) do local part = character:FindFirstChild(name) if part and part:IsA("BasePart") then local cf = part.CFrame local size = part.Size local x = size.X / 2 local y = size.Y / 2 local z = size.Z / 2 local corners = { Vector3.new(-x, -y, -z), Vector3.new(-x, -y, z), Vector3.new(-x, y, -z), Vector3.new(-x, y, z), Vector3.new(x, -y, -z), Vector3.new(x, -y, z), Vector3.new(x, y, -z), Vector3.new(x, y, z) } for _, offset in ipairs(corners) do local worldPosition = cf:PointToWorldSpace(offset) local screenPosition = camera:WorldToViewportPoint(worldPosition) if screenPosition.Z > 0 then found = true minX = math.min(minX, screenPosition.X) minY = math.min(minY, screenPosition.Y) maxX = math.max(maxX, screenPosition.X) maxY = math.max(maxY, screenPosition.Y) end end end end if not found then return nil end local width = maxX - minX local height = maxY - minY if width < 2 or height < 2 then return nil end local paddingX = math.max(2, width * 0.05) local paddingY = math.max(2, height * 0.025) minX -= paddingX maxX += paddingX minY -= paddingY maxY += paddingY return minX, minY, maxX, maxY end function NewESP.Update() if not NewESP.Enabled then NewESP.HideAll() return end local camera = workspace.CurrentCamera if not camera then return end local activePlayers = {} for _, player in ipairs(Players:GetPlayers()) do if player ~= LocalPlayer then local character = player.Character local humanoid = character and character:FindFirstChildOfClass("Humanoid") local root = character and character:FindFirstChild("HumanoidRootPart") if character and humanoid and root and humanoid.Health > 0 and root.Position.Y > -50 then activePlayers[player] = true local esp = NewESP.Cache[player] or NewESP.Create(player) local minX, minY, maxX, maxY = GetScreenBounds(character, camera) if minX then local width = maxX - minX local height = maxY - minY local centerX = minX + width / 2 local espColor = GetESPColor( player, character ) esp.Box.Position = UDim2.fromOffset( math.floor(minX), math.floor(minY) ) esp.Box.Size = UDim2.fromOffset( math.floor(width), math.floor(height) ) esp.BoxStroke.Color = espColor esp.Box.Visible = true local displayName = player.DisplayName if not displayName or displayName == "" then displayName = player.Name end esp.Name.Text = displayName esp.Name.TextColor3 = espColor local nameWidth = math.max( width + 80, 130 ) esp.Name.Size = UDim2.fromOffset( nameWidth, 18 ) esp.Name.Position = UDim2.fromOffset( centerX - nameWidth / 2, minY - 20 ) esp.Name.Visible = true local healthPercent = 0 if humanoid.MaxHealth > 0 then healthPercent = math.clamp( humanoid.Health / humanoid.MaxHealth, 0, 1 ) end local barWidth = 3 local barX = minX - 7 esp.HealthBg.Position = UDim2.fromOffset( barX - 1, minY - 1 ) esp.HealthBg.Size = UDim2.fromOffset( barWidth + 2, height + 2 ) esp.HealthBg.Visible = true local healthHeight = height * healthPercent esp.HealthBar.Position = UDim2.fromOffset( barX, maxY - healthHeight ) esp.HealthBar.Size = UDim2.fromOffset( barWidth, healthHeight ) esp.HealthBar.BackgroundColor3 = GetHealthColor( healthPercent ) esp.HealthBar.Visible = true esp.HealthText.Text = math.floor(humanoid.Health) .. " / " .. math.floor(humanoid.MaxHealth) local hpTextWidth = math.max( width + 80, 120 ) esp.HealthText.Size = UDim2.fromOffset( hpTextWidth, 16 ) esp.HealthText.Position = UDim2.fromOffset( centerX - hpTextWidth / 2, maxY + 2 ) esp.HealthText.Visible = true else NewESP.Hide(esp) end end end end for player, esp in pairs(NewESP.Cache) do if not activePlayers[player] then NewESP.DestroyESP(esp) NewESP.Cache[player] = nil end end end --@encrypt_start function MainModule.toggle_new_esp(enabled) if Encrypt and Encrypt.start then pcall(Encrypt.start) end NewESP.Enabled = enabled and true or false if NewESP.Enabled then if not NewESP.Connection then NewESP.Connection = RunService.RenderStepped:Connect(function() local ok, err = pcall(NewESP.Update) if not ok then warn("[NewESP]", err) end end) end else if NewESP.Connection then NewESP.Connection:Disconnect() NewESP.Connection = nil end NewESP.HideAll() NewESP.ClearAll() end PlayToggleSound() if Encrypt and Encrypt["end"] then pcall(Encrypt["end"]) end end --@encrypt_end function MainModule.toggle_esprgb(enabled) NewESP.RGB = enabled and true or false end MainModule.PlayerESPEnabled = MainModule.PlayerESPEnabled or false MainModule.ESPRGBEnabled = MainModule.ESPRGBEnabled or false MainModule.ESP_Mode = MainModule.ESP_Mode or "New" function MainModule.set_esp_mode(mode) MainModule.ESP_Mode = mode MainModule.toggle_new_esp(false) if MainModule.toggle_old_esp then MainModule.toggle_old_esp(false) end if MainModule.PlayerESPEnabled then if mode == "New" then MainModule.toggle_new_esp(true) elseif mode == "Old" and MainModule.toggle_old_esp then MainModule.toggle_old_esp(true) end end PlayToggleSound() end function MainModule.toggle_player_esp(enabled) MainModule.PlayerESPEnabled = enabled and true or false if enabled then if MainModule.ESP_Mode == "New" then MainModule.toggle_new_esp(true) elseif MainModule.toggle_old_esp then MainModule.toggle_old_esp(true) end else MainModule.toggle_new_esp(false) if MainModule.toggle_old_esp then MainModule.toggle_old_esp(false) end end PlayToggleSound() end MainModule.AutoSafe = { Enabled = false, Connection = nil, HasTeleported = false, LowHPChecked = false } MainModule.toggle_auto_safe = function(enabled) if MainModule.AutoSafe.Connection then MainModule.AutoSafe.Connection:Disconnect() MainModule.AutoSafe.Connection = nil end MainModule.AutoSafe.Enabled = enabled MainModule.AutoSafe.HasTeleported = false MainModule.AutoSafe.LowHPChecked = false if enabled then MainModule.AutoSafe.Connection = RunService.Heartbeat:Connect(function() if not MainModule.AutoSafe.Enabled then if MainModule.AutoSafe.Connection then MainModule.AutoSafe.Connection:Disconnect() MainModule.AutoSafe.Connection = nil end return end local noSafeGames = { "Mingle", "JumpRope", "Pentathlon", "GlassBridge", "SquidGame", "SkySquidGame", "RedLightGreenLight", "TugOfWar" } local isNoSafeGame = false for _, gameName in pairs(noSafeGames) do if MainModule.is_game_active(gameName) then isNoSafeGame = true break end end if isNoSafeGame then return end local character = MainModule.get_character() if character then local humanoid = character:FindFirstChildOfClass("Humanoid") if humanoid then if MainModule.is_game_active("HideAndSeek") or MainModule.is_game_active("LightsOut") or MainModule.is_game_active("LightOut") then if humanoid.Health <= 30 then if not MainModule.AutoSafe.HasTeleported then local rootPart = character:FindFirstChild("HumanoidRootPart") or character.PrimaryPart if rootPart then local currentPosition = rootPart.Position local newPosition = Vector3.new( currentPosition.X, currentPosition.Y + 150, currentPosition.Z ) rootPart.CFrame = CFrame.new(newPosition) MainModule.AutoSafe.HasTeleported = true MainModule.AutoSafe.LowHPChecked = true end end elseif humanoid.Health > 30 and MainModule.AutoSafe.HasTeleported then MainModule.AutoSafe.HasTeleported = false end else if humanoid.Health <= 30 then if not MainModule.AutoSafe.HasTeleported then local rootPart = character:FindFirstChild("HumanoidRootPart") or character.PrimaryPart if rootPart then local currentPosition = rootPart.Position local newPosition = Vector3.new( currentPosition.X, currentPosition.Y + 100, currentPosition.Z ) rootPart.CFrame = CFrame.new(newPosition) MainModule.AutoSafe.HasTeleported = true MainModule.AutoSafe.LowHPChecked = true end end elseif humanoid.Health > 30 and MainModule.AutoSafe.HasTeleported then MainModule.AutoSafe.HasTeleported = false end end end end end) else end PlayToggleSound() end MainModule.dalgona_lighter = function() if MainModule.is_game_active("Dalgona") then LocalPlayer:SetAttribute("HasLighter", true) else MainModule.notify("Dalgona","Wait for Dalgona!",0.9) PlayErrorSound() end PlayBell() end MainModule.AutoCollectFlashbang = false MainModule.AutoCollectFlashbangLoop = nil MainModule.toggle_auto_collect_flashbang = function(enabled) MainModule.AutoCollectFlashbang = enabled if MainModule.AutoCollectFlashbangLoop then task.cancel(MainModule.AutoCollectFlashbangLoop) MainModule.AutoCollectFlashbangLoop = nil end if enabled then MainModule.AutoCollectFlashbangLoop = task.spawn(function() while MainModule.AutoCollectFlashbang do local character = MainModule.get_character() if not character then task.wait(0.5) goto HSX_CONT_128 end local rootPart = MainModule.get_root_part(character) if not rootPart then task.wait(0.5) goto HSX_CONT_128 end local startCF = rootPart.CFrame if not MainModule.has_tool("Flashbang") then local found = false local effects = workspace:FindFirstChild("Effects") if effects then for _, effect in pairs(effects:GetChildren()) do if effect.Name == "DroppedFlashbang" and effect:FindFirstChild("Stun Grenade") then rootPart.CFrame = effect["Stun Grenade"].CFrame found = true break end end end if found then task.wait(0.3) rootPart.CFrame = startCF end end task.wait(0.5) ::HSX_CONT_128:: end end) else end PlayToggleSound() end MainModule.AutoCollectGrenade = false MainModule.AutoCollectGrenadeLoop = nil MainModule.toggle_auto_collect_grenade = function(enabled) MainModule.AutoCollectGrenade = enabled if MainModule.AutoCollectGrenadeLoop then task.cancel(MainModule.AutoCollectGrenadeLoop) MainModule.AutoCollectGrenadeLoop = nil end if enabled then MainModule.AutoCollectGrenadeLoop = task.spawn(function() while MainModule.AutoCollectGrenade do local character = MainModule.get_character() if not character then task.wait(0.5) goto HSX_CONT_130 end local rootPart = MainModule.get_root_part(character) if not rootPart then task.wait(0.5) goto HSX_CONT_130 end local startCF = rootPart.CFrame if not MainModule.has_tool("Grenade") then local found = false local effects = workspace:FindFirstChild("Effects") if effects then for _, effect in pairs(effects:GetChildren()) do if effect.Name == "DroppedGrenade" and effect:FindFirstChild("Handle") then rootPart.CFrame = effect.Handle.CFrame found = true break end end end if found then task.wait(0.3) rootPart.CFrame = startCF end end task.wait(0.5) ::HSX_CONT_130:: end end) else end PlayToggleSound() end MainModule.jr_tp_start = function() if MainModule.is_game_active("JumpRope") then MainModule.safe_teleport(Vector3.new(615.284424,192.274277,920.952515)) MainModule.notify("JumpRope","Teleported to Start",0.9) else MainModule.notify("JumpRope","Wait for JumpRope!",0.9) PlayErrorSound() end PlayBell() end MainModule.jr_tp_end = function() if MainModule.is_game_active("JumpRope") then MainModule.safe_teleport(Vector3.new(720.896057,198.628311,921.170654)) MainModule.notify("JumpRope","Teleported to End",0.9) else MainModule.notify("JumpRope","Wait for JumpRope!",0.9) PlayErrorSound() end PlayBell() end MainModule.jr_delete_rope = function() if MainModule.is_game_active("JumpRope") then for _,o in pairs(workspace:GetDescendants()) do if o.Name == "Rope" and (o:IsA("Model") or o:IsA("Part")) then o:Destroy() MainModule.notify("JumpRope","Rope deleted",0.9) PlayBell() return end end MainModule.notify("JumpRope","Rope not found",0.9) PlayErrorSound() else MainModule.notify("JumpRope","Wait for JumpRope!",0.9) PlayErrorSound() end PlayBell() end MainModule.GlobalAntiFall = { Enabled = false, Platform = nil, Conn = nil } function MainModule.toggle_global_anti_fall(enabled) MainModule.GlobalAntiFall.Enabled = enabled and true or false if MainModule.GlobalAntiFall.Conn then pcall(function() MainModule.GlobalAntiFall.Conn:Disconnect() end) MainModule.GlobalAntiFall.Conn = nil end if MainModule.GlobalAntiFall.Platform then pcall(function() MainModule.GlobalAntiFall.Platform:Destroy() end) MainModule.GlobalAntiFall.Platform = nil end if not enabled then PlayToggleSound() return true end local function make() local char = MainModule.get_character and MainModule.get_character() or LocalPlayer.Character local rp = char and (char:FindFirstChild("HumanoidRootPart") or char.PrimaryPart) if not rp then return nil end local p = Instance.new("Part") p.Name = HttpService:GenerateGUID(false) p.Size = Vector3.new(12, 1, 12) p.Anchored = true p.CanCollide = true p.Transparency = 0.5 p.Material = Enum.Material.SmoothPlastic p.Color = Color3.fromRGB(100, 100, 100) p.CFrame = CFrame.new(rp.Position.X, rp.Position.Y - 3.5, rp.Position.Z) p.Parent = workspace return p end MainModule.GlobalAntiFall.Platform = make() MainModule.GlobalAntiFall.Conn = RunService.Heartbeat:Connect(function() if not MainModule.GlobalAntiFall.Enabled then return end local char = MainModule.get_character and MainModule.get_character() or LocalPlayer.Character local rp = char and (char:FindFirstChild("HumanoidRootPart") or char.PrimaryPart) if not rp then return end if not (MainModule.GlobalAntiFall.Platform and MainModule.GlobalAntiFall.Platform.Parent) then MainModule.GlobalAntiFall.Platform = make() end if MainModule.GlobalAntiFall.Platform then MainModule.GlobalAntiFall.Platform.CFrame = CFrame.new(rp.Position.X, rp.Position.Y - 3.5, rp.Position.Z) MainModule.GlobalAntiFall.Platform.Transparency = 0.5 end end) PlayToggleSound() return true end MainModule.JumpRopeAntiFall = {Enabled=false, Platform=nil, Conn=nil} MainModule.toggle_jump_rope_anti_fall = function(enabled) local toggleRef = MainModule.ToggleRefs.JumpRopeAntiFall if enabled then if not MainModule.can_enable_toggle("JumpRope", "Anti Fall", toggleRef) then return false end end if MainModule.JumpRopeAntiFall.Conn then MainModule.JumpRopeAntiFall.Conn:Disconnect() end if MainModule.JumpRopeAntiFall.Platform then MainModule.JumpRopeAntiFall.Platform:Destroy() end MainModule.JumpRopeAntiFall.Enabled = enabled if enabled then local function create() local c = MainModule.get_character() if not c then return nil end local rp = MainModule.get_root_part(c) if not rp then return nil end local p = Instance.new("Part") p.Name = HttpService:GenerateGUID(false) p.Size = Vector3.new(10000,1,10000) p.Position = Vector3.new(rp.Position.X, rp.Position.Y-5, rp.Position.Z) p.Anchored = true p.CanCollide = true p.Transparency = 0.5 p.Parent = workspace return p end MainModule.JumpRopeAntiFall.Platform = create() MainModule.JumpRopeAntiFall.Conn = RunService.Heartbeat:Connect(function() if not MainModule.JumpRopeAntiFall.Enabled then return end if not MainModule.is_game_active("JumpRope") then MainModule.disable_toggle("JumpRopeAntiFall") return end if not (MainModule.JumpRopeAntiFall.Platform and MainModule.JumpRopeAntiFall.Platform.Parent) then MainModule.JumpRopeAntiFall.Platform = create() end end) else end PlayToggleSound() return true end MainModule.gb_tp_end = function() if MainModule.is_game_active("GlassBridge") then MainModule.safe_teleport(Vector3.new(-196.372467,522.192139,-1534.20984)) MainModule.notify("GlassBridge","Teleported to End",0.9) else MainModule.notify("GlassBridge","Wait for GlassBridge!",0.9) PlayErrorSound() end PlayBell() end MainModule.GlassESPEnabled = false MainModule.GlassESPConnection = nil MainModule.GlassESPHighlighted = {} MainModule.GlassESPOriginal = {} MainModule.toggle_glass_esp = function(enabled) local toggleRef = MainModule.ToggleRefs.GlassESP if enabled then if not MainModule.can_enable_toggle("GlassBridge", "Glass ESP", toggleRef) then return false end end MainModule.GlassESPEnabled = enabled and true or false if MainModule.GlassESPConnection then pcall(function() MainModule.GlassESPConnection:Disconnect() end) MainModule.GlassESPConnection = nil end for part, orig in pairs(MainModule.GlassESPOriginal) do if part and part.Parent then pcall(function() part.Color = orig.Color part.Material = orig.Material end) end end MainModule.GlassESPOriginal = {} MainModule.GlassESPHighlighted = {} if not enabled then PlayToggleSound() return true end local glassHolder = workspace:FindFirstChild("GlassBridge") and workspace.GlassBridge:FindFirstChild("GlassHolder") if not glassHolder then PlayToggleSound() return true end local function getGlassType(part) if not part:GetAttribute("GlassPart") then return nil end local hasActuallyKilling = part:GetAttribute("ActuallyKilling") ~= nil local hasDelayedBreaking = part:GetAttribute("DelayedBreaking") ~= nil if hasActuallyKilling and hasDelayedBreaking then return "delayed" elseif hasActuallyKilling then return "fake" else return "real" end end local glassColors = { real = Color3.fromRGB(0, 255, 0), delayed = Color3.fromRGB(255, 200, 0), fake = Color3.fromRGB(255, 0, 0) } for _, part in ipairs(glassHolder:GetDescendants()) do if part:IsA("BasePart") and part:GetAttribute("GlassPart") then local glassType = getGlassType(part) if glassType then if not MainModule.GlassESPOriginal[part] then MainModule.GlassESPOriginal[part] = { Color = part.Color, Material = part.Material } end part.Color = glassColors[glassType] part.Material = Enum.Material.Neon MainModule.GlassESPHighlighted[part] = glassType end end end MainModule.GlassESPConnection = RunService.RenderStepped:Connect(function() if not MainModule.GlassESPEnabled then return end if not glassHolder.Parent then if MainModule.GlassESPConnection then MainModule.GlassESPConnection:Disconnect() MainModule.GlassESPConnection = nil end return end for part, glassType in pairs(MainModule.GlassESPHighlighted) do if part and part.Parent then part.Color = glassColors[glassType] part.Material = Enum.Material.Neon else MainModule.GlassESPHighlighted[part] = nil end end end) PlayToggleSound() return true end function MainModule.set_title(value) MainModule.CurrentTitleValue = value if MainModule.TitleEnabled then MainModule.update_title() end end MainModule.AntiBreakEnabled = false MainModule.AntiBreakConn = nil MainModule.SafetyPlatforms = {} MainModule.toggle_anti_break = function(enabled) enabled = enabled and true or false MainModule.AntiBreakEnabled = enabled if MainModule.AntiBreakConn then pcall(function() MainModule.AntiBreakConn:Disconnect() end) MainModule.AntiBreakConn = nil end local function stripGlassTouches() local glassBridge = Workspace:FindFirstChild("GlassBridge") if not glassBridge then return end local glassHolder = glassBridge:FindFirstChild("GlassHolder") if not glassHolder then return end for _, descendant in ipairs(glassHolder:GetDescendants()) do if descendant:IsA("TouchTransmitter") or (descendant:IsA("ProximityPrompt") or (typeof(descendant.Name) == "string" and descendant.Name:lower():find("touch"))) then pcall(function() descendant:Destroy() end) elseif descendant:IsA("BasePart") then for _, child in ipairs(descendant:GetChildren()) do if child.ClassName == "TouchInterest" then pcall(function() child:Destroy() end) end end end end end if enabled then stripGlassTouches() MainModule.AntiBreakConn = RunService.Heartbeat:Connect(function() if not MainModule.AntiBreakEnabled then return end -- throttle every ~1s via attribute stamp local now = tick() if (MainModule._AntiBreakLast or 0) + 1 > now then return end MainModule._AntiBreakLast = now pcall(stripGlassTouches) end) end if PlayToggleSound then PlayToggleSound() end return true end MainModule.FreezeRopeEnabled = false MainModule.FreezeRopeConnection = nil MainModule.toggle_freeze_rope = function(enabled) MainModule.FreezeRopeEnabled = enabled local rope = workspace:FindFirstChild("Effects") and workspace.Effects:FindFirstChild("rope") if not rope then if MainModule.ToggleRefs.FreezeRope then pcall(function() MainModule.ToggleRefs.FreezeRope:SetValue(false) end) end return end if enabled then for _, part in ipairs(rope:GetDescendants()) do if part:IsA("BasePart") then part.Anchored = true part.Velocity = Vector3.zero part.RotVelocity = Vector3.zero elseif part:IsA("Constraint") or part:IsA("RopeConstraint") or part:IsA("Motor6D") then part.Enabled = false end end else for _, part in ipairs(rope:GetDescendants()) do if part:IsA("BasePart") then part.Anchored = false elseif part:IsA("Constraint") or part:IsA("RopeConstraint") or part:IsA("Motor6D") then part.Enabled = true end end end PlayToggleSound() end MainModule.remove_balance_mini_game = function() local playingJumpRope = LocalPlayer:FindFirstChild("PlayingJumpRope") if playingJumpRope then pcall(function() playingJumpRope:Destroy() end) PlayBell() else MainModule.notify("Jump Rope", "PlayingJumpRope not found", 0.9) PlayErrorSound() end end MainModule.AutoJumpEnabled = false MainModule.AutoJumpLoop = nil MainModule.toggle_auto_jump = function(enabled) MainModule.AutoJumpEnabled = enabled if MainModule.AutoJumpLoop then task.cancel(MainModule.AutoJumpLoop) MainModule.AutoJumpLoop = nil end if enabled then MainModule.AutoJumpLoop = task.spawn(function() while MainModule.AutoJumpEnabled do local rope = workspace:FindFirstChild("Effects") and workspace.Effects:FindFirstChild("rope") local character = MainModule.get_character() if rope and character then local rootPart = MainModule.get_root_part(character) if rootPart and (rootPart.Position - rope.Position).Magnitude <= 15 then local humanoid = MainModule.get_humanoid(character) if humanoid and humanoid.Health > 0 then humanoid:ChangeState(Enum.HumanoidStateType.Jumping) end end end task.wait(1) end end) else end PlayToggleSound() end MainModule.JumpRopeAntiHit = { Enabled = false, Connection = nil, AnimationId = "rbxassetid://105677261748140", AnimationDuration = 0.4, CurrentAnimation = nil, StopTimer = nil, WasJumping = false, RopeDestroyed = false } MainModule.JumpRopeFakeBalance = { Enabled = false, Connection = nil, AnimationId = "rbxassetid://105677261748140", AnimationDuration = 0.4, CurrentAnimation = nil, StopTimer = nil, WasJumping = false } function MainModule.play_land_animation_fake_balance() if not MainModule.JumpRopeFakeBalance.Enabled then return end local character = MainModule.get_character() if not character then return end local humanoid = MainModule.get_humanoid(character) if not humanoid then return end if MainModule.JumpRopeFakeBalance.CurrentAnimation then pcall(function() MainModule.JumpRopeFakeBalance.CurrentAnimation:Stop() end) end if MainModule.JumpRopeFakeBalance.StopTimer then MainModule.JumpRopeFakeBalance.StopTimer:Disconnect() MainModule.JumpRopeFakeBalance.StopTimer = nil end local anim = Instance.new("Animation") anim.AnimationId = MainModule.JumpRopeFakeBalance.AnimationId MainModule.JumpRopeFakeBalance.CurrentAnimation = humanoid:LoadAnimation(anim) pcall(function() MainModule.JumpRopeFakeBalance.CurrentAnimation:Play() end) MainModule.JumpRopeFakeBalance.StopTimer = game:GetService("RunService").Stepped:Connect(function() task.wait(MainModule.JumpRopeFakeBalance.AnimationDuration) if MainModule.JumpRopeFakeBalance.CurrentAnimation then pcall(function() MainModule.JumpRopeFakeBalance.CurrentAnimation:Stop() end) MainModule.JumpRopeFakeBalance.CurrentAnimation = nil end if MainModule.JumpRopeFakeBalance.StopTimer then MainModule.JumpRopeFakeBalance.StopTimer:Disconnect() MainModule.JumpRopeFakeBalance.StopTimer = nil end end) end function MainModule.setup_jump_rope_fake_balance() local character = MainModule.get_character() if not character then return end local humanoid = MainModule.get_humanoid(character) if not humanoid then return end MainModule.JumpRopeFakeBalance.WasJumping = false humanoid.StateChanged:Connect(function(oldState, newState) if not MainModule.JumpRopeFakeBalance.Enabled then return end if newState == Enum.HumanoidStateType.Jumping then MainModule.JumpRopeFakeBalance.WasJumping = true end if MainModule.JumpRopeFakeBalance.WasJumping and (newState == Enum.HumanoidStateType.Running or newState == Enum.HumanoidStateType.Landed or newState == Enum.HumanoidStateType.GettingUp) then MainModule.play_land_animation_fake_balance() MainModule.JumpRopeFakeBalance.WasJumping = false end end) end function MainModule.toggle_jump_rope_fake_balance(enabled) local toggleRef = MainModule.ToggleRefs.JumpRopeFakeBalance if enabled then if not MainModule.can_enable_toggle("JumpRope", "Fake Balance", toggleRef) then return false end end if MainModule.JumpRopeFakeBalance.Connection then MainModule.JumpRopeFakeBalance.Connection:Disconnect() MainModule.JumpRopeFakeBalance.Connection = nil end if MainModule.JumpRopeFakeBalance.CurrentAnimation then pcall(function() MainModule.JumpRopeFakeBalance.CurrentAnimation:Stop() end) MainModule.JumpRopeFakeBalance.CurrentAnimation = nil end if MainModule.JumpRopeFakeBalance.StopTimer then MainModule.JumpRopeFakeBalance.StopTimer:Disconnect() MainModule.JumpRopeFakeBalance.StopTimer = nil end MainModule.JumpRopeFakeBalance.Enabled = enabled if enabled then MainModule.setup_jump_rope_fake_balance() MainModule.JumpRopeFakeBalance.Connection = RunService.Heartbeat:Connect(function() if not MainModule.JumpRopeFakeBalance.Enabled then return end if not MainModule.is_game_active("JumpRope") then if MainModule.ToggleRefs.JumpRopeFakeBalance then pcall(function() MainModule.ToggleRefs.JumpRopeFakeBalance:SetValue(false) end) end MainModule.toggle_jump_rope_fake_balance(false) return end end) end PlayToggleSound() return true end function MainModule.disable_rope_objects(obj) if not obj then return end pcall(function() if obj:IsA("MeshPart") or obj:IsA("Part") or obj:IsA("BasePart") then obj.CanCollide = false obj.CanTouch = false obj.CanQuery = false obj.Massless = true if obj.TouchTransmitter then obj.TouchTransmitter:Destroy() end end if obj:IsA("Script") or obj:IsA("LocalScript") or obj:IsA("ModuleScript") then local name = obj.Name:lower() if name:find("rope") or name:find("jump") or name:find("carry") or name:find("damage") or name:find("hurt") then obj.Disabled = true end end if obj:IsA("RopeConstraint") then obj:Destroy() end local name = obj.Name or "" if name == "PlayingJumpRope" or name == "RopeCarryPrompt" then obj:Destroy() end end) end function MainModule.search_and_destroy_rope(parent) if not parent then return end for _, obj in pairs(parent:GetDescendants()) do if obj.Name and obj.Name:lower():find("rope") then MainModule.disable_rope_objects(obj) end if obj:IsA("RopeConstraint") then MainModule.disable_rope_objects(obj) end if obj.Name == "PlayingJumpRope" or obj.Name == "RopeCarryPrompt" then MainModule.disable_rope_objects(obj) end end end function MainModule.destroy_all_ropes() MainModule.search_and_destroy_rope(workspace) pcall(function() MainModule.search_and_destroy_rope(game:GetService("ReplicatedStorage")) end) pcall(function() MainModule.search_and_destroy_rope(game:GetService("ServerStorage")) end) pcall(function() MainModule.search_and_destroy_rope(game:GetService("ServerScriptService")) end) pcall(function() for _, player in pairs(Players:GetPlayers()) do if player.Character then MainModule.search_and_destroy_rope(player.Character) end if player.PlayerGui then MainModule.search_and_destroy_rope(player.PlayerGui) end end end) MainModule.JumpRopeAntiHit.RopeDestroyed = true end function MainModule.disable_damage_scripts() pcall(function() local replicatedStorage = game:GetService("ReplicatedStorage") for _, obj in pairs(replicatedStorage:GetDescendants()) do if obj:IsA("Script") or obj:IsA("LocalScript") or obj:IsA("ModuleScript") then local name = obj.Name:lower() if name:find("rope") or name:find("jump") or name:find("carry") or name:find("damage") or name:find("hurt") then obj.Disabled = true end end end end) pcall(function() local serverStorage = game:GetService("ServerStorage") for _, obj in pairs(serverStorage:GetDescendants()) do if obj:IsA("Script") or obj:IsA("LocalScript") or obj:IsA("ModuleScript") then local name = obj.Name:lower() if name:find("rope") or name:find("jump") or name:find("carry") or name:find("damage") or name:find("hurt") then obj.Disabled = true end end end end) pcall(function() local serverScriptService = game:GetService("ServerScriptService") for _, obj in pairs(serverScriptService:GetDescendants()) do if obj:IsA("Script") or obj:IsA("LocalScript") or obj:IsA("ModuleScript") then local name = obj.Name:lower() if name:find("rope") or name:find("jump") or name:find("carry") or name:find("damage") or name:find("hurt") then obj.Disabled = true end end end end) end function MainModule.toggle_jump_rope_anti_hit(enabled) local toggleRef = MainModule.ToggleRefs.JumpRopeAntiHit if enabled then if not MainModule.can_enable_toggle("JumpRope", "AntiHit", toggleRef) then return false end end if MainModule.JumpRopeAntiHit.Connection then MainModule.JumpRopeAntiHit.Connection:Disconnect() MainModule.JumpRopeAntiHit.Connection = nil end MainModule.JumpRopeAntiHit.Enabled = enabled MainModule.JumpRopeAntiHit.RopeDestroyed = false if enabled then MainModule.disable_damage_scripts() MainModule.destroy_all_ropes() MainModule.JumpRopeAntiHit.Connection = RunService.Heartbeat:Connect(function() if not MainModule.JumpRopeAntiHit.Enabled then return end if not MainModule.is_game_active("JumpRope") then if MainModule.ToggleRefs.JumpRopeAntiHit then pcall(function() MainModule.ToggleRefs.JumpRopeAntiHit:SetValue(false) end) end MainModule.toggle_jump_rope_anti_hit(false) return end if not MainModule.JumpRopeAntiHit.RopeDestroyed then MainModule.destroy_all_ropes() end end) end PlayToggleSound() return true end MainModule.ToggleRefs.JumpRopeAntiHit = nil MainModule.ToggleRefs.JumpRopeFakeBalance = nil MainModule.ZoneKillFeature = { Enabled = false, AnimationId = "rbxassetid://105341857343164", ZonePosition = Vector3.new(197.7, 54.6, -96.3), ReturnDelay = 0.6, SavedCFrame = nil, ActiveAnimation = false, AnimationStartTime = 0, AnimationConnection = nil, CharacterAddedConnection = nil, AnimationStoppedConnections = {}, AnimationCheckConnection = nil, TrackedAnimations = {} } function MainModule.toggle_zone_kill(enabled) local toggleRef = MainModule.ToggleRefs.ZoneKill if enabled then if not MainModule.can_enable_toggle("LastDinner", "Zone Kill", toggleRef) then return false end end MainModule.ZoneKillFeature.Enabled = enabled if MainModule.ZoneKillFeature.AnimationConnection then MainModule.ZoneKillFeature.AnimationConnection:Disconnect() MainModule.ZoneKillFeature.AnimationConnection = nil end if MainModule.ZoneKillFeature.CharacterAddedConnection then MainModule.ZoneKillFeature.CharacterAddedConnection:Disconnect() MainModule.ZoneKillFeature.CharacterAddedConnection = nil end if MainModule.ZoneKillFeature.AnimationCheckConnection then MainModule.ZoneKillFeature.AnimationCheckConnection:Disconnect() MainModule.ZoneKillFeature.AnimationCheckConnection = nil end for _, conn in ipairs(MainModule.ZoneKillFeature.AnimationStoppedConnections) do pcall(function() conn:Disconnect() end) end MainModule.ZoneKillFeature.AnimationStoppedConnections = {} MainModule.ZoneKillFeature.SavedCFrame = nil MainModule.ZoneKillFeature.ActiveAnimation = false MainModule.ZoneKillFeature.AnimationStartTime = 0 MainModule.ZoneKillFeature.TrackedAnimations = {} if not enabled then PlayToggleSound() return true end local function checkAnimations() if not MainModule.ZoneKillFeature.Enabled then return end local character = MainModule.get_character() if not character then return end local humanoid = MainModule.get_humanoid(character) if not humanoid then return end local activeTracks = humanoid:GetPlayingAnimationTracks() for _, track in pairs(activeTracks) do if track and track.Animation then local animId = track.Animation.AnimationId if animId and animId == MainModule.ZoneKillFeature.AnimationId then local trackKey = animId .. "_" .. tostring(track) if not MainModule.ZoneKillFeature.TrackedAnimations[trackKey] then MainModule.ZoneKillFeature.TrackedAnimations[trackKey] = true if not MainModule.ZoneKillFeature.ActiveAnimation then MainModule.ZoneKillFeature.ActiveAnimation = true MainModule.ZoneKillFeature.AnimationStartTime = tick() MainModule.ZoneKillFeature.SavedCFrame = character:GetPrimaryPartCFrame() character:SetPrimaryPartCFrame(CFrame.new(MainModule.ZoneKillFeature.ZonePosition)) local stoppedConn = track.Stopped:Connect(function() task.wait(MainModule.ZoneKillFeature.ReturnDelay) if MainModule.ZoneKillFeature.SavedCFrame then character:SetPrimaryPartCFrame(MainModule.ZoneKillFeature.SavedCFrame) MainModule.ZoneKillFeature.SavedCFrame = nil MainModule.ZoneKillFeature.ActiveAnimation = false MainModule.ZoneKillFeature.TrackedAnimations = {} end end) table.insert(MainModule.ZoneKillFeature.AnimationStoppedConnections, stoppedConn) end end end end end end local function setupCharacter(char) local humanoid = char:WaitForChild("Humanoid", 5) if not humanoid then return end MainModule.ZoneKillFeature.AnimationConnection = humanoid.AnimationPlayed:Connect(function(track) if not MainModule.ZoneKillFeature.Enabled then return end if track and track.Animation then local animId = track.Animation.AnimationId if animId and animId == MainModule.ZoneKillFeature.AnimationId then local trackKey = animId .. "_" .. tostring(track) MainModule.ZoneKillFeature.TrackedAnimations[trackKey] = true if not MainModule.ZoneKillFeature.ActiveAnimation then MainModule.ZoneKillFeature.ActiveAnimation = true MainModule.ZoneKillFeature.AnimationStartTime = tick() MainModule.ZoneKillFeature.SavedCFrame = char:GetPrimaryPartCFrame() char:SetPrimaryPartCFrame(CFrame.new(MainModule.ZoneKillFeature.ZonePosition)) local stoppedConn = track.Stopped:Connect(function() task.wait(MainModule.ZoneKillFeature.ReturnDelay) if MainModule.ZoneKillFeature.SavedCFrame then char:SetPrimaryPartCFrame(MainModule.ZoneKillFeature.SavedCFrame) MainModule.ZoneKillFeature.SavedCFrame = nil end MainModule.ZoneKillFeature.ActiveAnimation = false MainModule.ZoneKillFeature.TrackedAnimations = {} end) table.insert(MainModule.ZoneKillFeature.AnimationStoppedConnections, stoppedConn) end end end end) end local char = LocalPlayer.Character if char then setupCharacter(char) end MainModule.ZoneKillFeature.CharacterAddedConnection = LocalPlayer.CharacterAdded:Connect(function(newChar) task.wait(1) setupCharacter(newChar) end) MainModule.ZoneKillFeature.AnimationCheckConnection = RunService.Heartbeat:Connect(function() if not MainModule.ZoneKillFeature.Enabled then return end checkAnimations() end) PlayToggleSound() return true end MainModule.VoidKillEnabled = false MainModule.VoidKillConn = nil MainModule.VoidKillCharConn = nil MainModule.VoidAnimIds = {"rbxassetid://107989020363293","rbxassetid://71619354165195"} MainModule.VoidZonePos = Vector3.new(-95.1,964.6,67.6) MainModule.toggle_void_kill = function(enabled) local toggleRef = MainModule.ToggleRefs.VoidKill if enabled then if not MainModule.can_enable_toggle("SkySquidGame", "Void Kill", toggleRef) then return false end end if MainModule.VoidKillConn then MainModule.VoidKillConn:Disconnect() end if MainModule.VoidKillCharConn then MainModule.VoidKillCharConn:Disconnect() end MainModule.VoidKillEnabled = enabled if enabled then local function setup(char) local h = char:WaitForChild("Humanoid") MainModule.VoidKillConn = h.AnimationPlayed:Connect(function(track) if track.Animation and table.find(MainModule.VoidAnimIds, track.Animation.AnimationId) then local orig = char:GetPrimaryPartCFrame() local platform = Instance.new("Part") platform.Name = HttpService:GenerateGUID(false) platform.Size = Vector3.new(10,1,10) platform.Position = MainModule.VoidZonePos + Vector3.new(0,-4,0) platform.Anchored = true platform.CanCollide = true platform.Transparency = 1 platform.Parent = workspace char:SetPrimaryPartCFrame(CFrame.new(MainModule.VoidZonePos.X, MainModule.VoidZonePos.Y, MainModule.VoidZonePos.Z)) track.Stopped:Connect(function() task.wait(1) if orig then char:SetPrimaryPartCFrame(orig) end platform:Destroy() end) end end) end if LocalPlayer.Character then setup(LocalPlayer.Character) end MainModule.VoidKillCharConn = LocalPlayer.CharacterAdded:Connect(function(char) task.wait(1); setup(char) end) else end PlayToggleSound() return true end MainModule.MingleVoidKillEnabled = false MainModule.MingleConns = {} MainModule.MingleAnimId = "rbxassetid://71318091779666" MainModule.toggle_mingle_void_kill = function(enabled) local toggleRef = MainModule.ToggleRefs.MingleVoidKill if enabled then if not MainModule.can_enable_toggle("Mingle", "Void Kill", toggleRef) then return false end end for _,c in pairs(MainModule.MingleConns) do pcall(function() c:Disconnect() end) end MainModule.MingleConns = {} MainModule.MingleVoidKillEnabled = enabled if enabled then local platform = nil local function setup(char) local h = char:FindFirstChildOfClass("Humanoid") or char:WaitForChild("Humanoid", 5) if not h then return end local conn = h.AnimationPlayed:Connect(function(track) if not MainModule.MingleVoidKillEnabled then return end if not track.Animation then return end if track.Animation.AnimationId ~= MainModule.MingleAnimId then return end local rp = char:FindFirstChild("HumanoidRootPart") if not rp then return end local returnCFrame = rp.CFrame local spawnPos = Vector3.new(196.83342, 55.9547985, -90.4745865) if platform then pcall(function() platform:Destroy() end) platform = nil end platform = Instance.new("Part") platform.Name = HttpService:GenerateGUID(false) platform.Size = Vector3.new(40, 2, 40) platform.Position = spawnPos + Vector3.new(0, -3, 0) platform.Anchored = true platform.CanCollide = true platform.Transparency = 1 platform.Parent = workspace rp.AssemblyLinearVelocity = Vector3.zero rp.CFrame = CFrame.new(spawnPos) if char.PrimaryPart then pcall(function() char:SetPrimaryPartCFrame(CFrame.new(spawnPos)) end) end local stopConn stopConn = track.Stopped:Connect(function() task.wait(0.6) if char and char.Parent and MainModule.MingleVoidKillEnabled then local root = char:FindFirstChild("HumanoidRootPart") if root then root.AssemblyLinearVelocity = Vector3.zero root.CFrame = returnCFrame if char.PrimaryPart then pcall(function() char:SetPrimaryPartCFrame(returnCFrame) end) end end end if platform then pcall(function() platform:Destroy() end) platform = nil end if stopConn then stopConn:Disconnect() end end) end) table.insert(MainModule.MingleConns, conn) end if LocalPlayer.Character then setup(LocalPlayer.Character) end table.insert(MainModule.MingleConns, LocalPlayer.CharacterAdded:Connect(function(char) task.wait(0.5); setup(char) end)) end PlayToggleSound() return true end MainModule.AutoChokeEnabled = false MainModule.AutoChokeConnection = nil MainModule.toggle_auto_choke = function(enabled) local toggleRef = MainModule.ToggleRefs.AutoChoke if enabled then if not MainModule.can_enable_toggle("Mingle", "Auto Choke", toggleRef) then return false end end MainModule.AutoChokeEnabled = enabled if enabled then local ImpactFrames = LocalPlayer.PlayerGui:FindFirstChild("ImpactFrames") if ImpactFrames then local processed = {} ImpactFrames.ChildAdded:Connect(function(outer) if outer.Name ~= "OuterRingTemplate" or processed[outer] then return end processed[outer] = true task.defer(function() local inner = nil for _, g in pairs(ImpactFrames:GetChildren()) do if g.Name == "InnerTemplate" and g.Position == outer.Position and not g:GetAttribute("Failed") then inner = g; break end end if not inner or inner:GetAttribute("Tweening") or inner:GetAttribute("Failed") then return end local HBGQTE = require(ReplicatedStorage.Modules.HBGQTE) pcall(function() HBGQTE.Pressed(false, {Inner=inner, Outer=outer, Duration=2, StartedAt=tick(), Data={}}) end) end) end) end else end PlayToggleSound() return true end MainModule.SkySquidAntiFall = {Enabled=false, Platform=nil, Conn=nil} MainModule.toggle_sky_squid_anti_fall = function(enabled) if MainModule.SkySquidAntiFall.Conn then MainModule.SkySquidAntiFall.Conn:Disconnect() end if MainModule.SkySquidAntiFall.Platform then MainModule.SkySquidAntiFall.Platform:Destroy() end MainModule.SkySquidAntiFall.Enabled = enabled if enabled then local function create() local c = MainModule.get_character() if not c then return nil end local rp = MainModule.get_root_part(c) if not rp then return nil end local p = Instance.new("Part") p.Name = HttpService:GenerateGUID(false) p.Size = Vector3.new(10000,1,10000) p.Position = Vector3.new(rp.Position.X, rp.Position.Y-5, rp.Position.Z) p.Anchored = true p.CanCollide = true p.Transparency = 0.5 p.Parent = workspace return p end MainModule.SkySquidAntiFall.Platform = create() MainModule.SkySquidAntiFall.Conn = RunService.Heartbeat:Connect(function() if not MainModule.SkySquidAntiFall.Enabled then return end if not (MainModule.SkySquidAntiFall.Platform and MainModule.SkySquidAntiFall.Platform.Parent) then MainModule.SkySquidAntiFall.Platform = create() end end) else end PlayToggleSound() return true end MainModule.FullbrightEnabled = false MainModule.FullbrightSettings = {} MainModule.FullbrightConnection = nil MainModule.toggle_fullbright = function(enabled) MainModule.FullbrightEnabled = enabled local Lighting = game:GetService("Lighting") if enabled then MainModule.FullbrightSettings.Brightness = Lighting.Brightness MainModule.FullbrightSettings.ClockTime = Lighting.ClockTime MainModule.FullbrightSettings.FogEnd = Lighting.FogEnd MainModule.FullbrightSettings.GlobalShadows = Lighting.GlobalShadows MainModule.FullbrightSettings.OutdoorAmbient = Lighting.OutdoorAmbient MainModule.FullbrightSettings.Ambient = Lighting.Ambient Lighting.Brightness = 2 Lighting.ClockTime = 14 Lighting.FogEnd = 100000 Lighting.GlobalShadows = false Lighting.OutdoorAmbient = Color3.fromRGB(128, 128, 128) Lighting.Ambient = Color3.fromRGB(255, 255, 255) if MainModule.FullbrightConnection then MainModule.FullbrightConnection:Disconnect() end MainModule.FullbrightConnection = Lighting.Changed:Connect(function(property) if not MainModule.FullbrightEnabled then return end Lighting.Brightness = 2 Lighting.ClockTime = 14 Lighting.FogEnd = 100000 Lighting.GlobalShadows = false Lighting.OutdoorAmbient = Color3.fromRGB(128, 128, 128) Lighting.Ambient = Color3.fromRGB(255, 255, 255) end) else for property, value in pairs(MainModule.FullbrightSettings) do pcall(function() Lighting[property] = value end) end if MainModule.FullbrightConnection then MainModule.FullbrightConnection:Disconnect() MainModule.FullbrightConnection = nil end end PlayToggleSound() end MainModule.AutoCollectBandage = false MainModule.AutoCollectBandageConnection = nil function MainModule.has_tool(toolName) local char = MainModule.get_character() if char then for _, tool in pairs(char:GetChildren()) do if tool:IsA("Tool") and tool.Name == toolName then return true end end end local backpack = LocalPlayer:FindFirstChild("Backpack") if backpack then for _, tool in pairs(backpack:GetChildren()) do if tool:IsA("Tool") and tool.Name == toolName then return true end end end return false end function MainModule.start_auto_collect_bandage() if MainModule.AutoCollectBandageConnection then MainModule.AutoCollectBandageConnection:Disconnect() MainModule.AutoCollectBandageConnection = nil end MainModule.AutoCollectBandageConnection = RunService.Heartbeat:Connect(function() if not MainModule.AutoCollectBandage then return end if not MainModule.has_tool("Bandage") and LocalPlayer.Character and LocalPlayer.Character:FindFirstChild("HumanoidRootPart") then local effects = workspace:FindFirstChild("Effects") if effects then for _, v in pairs(effects:GetChildren()) do if v.Name == "DroppedBandage" and v:FindFirstChild("Handle") then local oldCFrame = LocalPlayer.Character.HumanoidRootPart.CFrame LocalPlayer.Character.HumanoidRootPart.CFrame = v.Handle.CFrame task.wait(0.3) if LocalPlayer.Character and LocalPlayer.Character:FindFirstChild("HumanoidRootPart") then LocalPlayer.Character.HumanoidRootPart.CFrame = oldCFrame end break end end end end end) end function MainModule.toggle_auto_collect_bandage(enabled) MainModule.AutoCollectBandage = enabled if enabled then MainModule.start_auto_collect_bandage() else if MainModule.AutoCollectBandageConnection then MainModule.AutoCollectBandageConnection:Disconnect() MainModule.AutoCollectBandageConnection = nil end end PlayToggleSound() end MainModule.RLGLEndCorner = MainModule.RLGLEndCorner or "Left Corner" MainModule.RLGLEndPositions = { ["Left Corner"] = Vector3.new(110, 1023, 133), ["Right Corner"] = Vector3.new(-214.4, 1023.1, 146.7), } MainModule.rlgl_tp_end = function() if MainModule.is_game_active("RedLightGreenLight") then local corner = MainModule.RLGLEndCorner or "Left Corner" local pos = (MainModule.RLGLEndPositions and MainModule.RLGLEndPositions[corner]) or Vector3.new(110, 1023, 133) MainModule.safe_teleport(pos) MainModule.notify("RLGL", "Teleported to " .. tostring(corner), 0.9) else MainModule.notify("RLGL","Wait for RedLightGreenLight!",0.9) PlayErrorSound() end end MainModule.GodModeEnabled = false MainModule.GodModeConn = nil MainModule.GodModeOrigY = nil MainModule.toggle_god_mode = function(enabled) local toggleRef = MainModule.ToggleRefs.GodMode if enabled then if not MainModule.can_enable_toggle("RedLightGreenLight", "God Mode", toggleRef) then return false end end if enabled then if MainModule.GodModeConn then MainModule.GodModeConn:Disconnect(); MainModule.GodModeConn = nil end MainModule.GodModeEnabled = true local c = MainModule.get_character() if not c then MainModule.notify("GodMode","Character not found",0.9); PlayErrorSound(); MainModule.GodModeEnabled=false; return false end local rp = c:FindFirstChild("HumanoidRootPart") or c.PrimaryPart if rp then MainModule.GodModeOrigY = rp.Position.Y MainModule.safe_teleport(Vector3.new(rp.Position.X, rp.Position.Y+170, rp.Position.Z)) end MainModule.GodModeConn = RunService.Heartbeat:Connect(function() if MainModule.GodModeEnabled and not MainModule.is_game_active("RedLightGreenLight") then MainModule.disable_toggle("GodMode") end end) else MainModule.GodModeEnabled = false if MainModule.GodModeConn then MainModule.GodModeConn:Disconnect(); MainModule.GodModeConn = nil end if MainModule.GodModeOrigY then local c = MainModule.get_character() if c then local rp = c:FindFirstChild("HumanoidRootPart") if rp then MainModule.safe_teleport(Vector3.new(rp.Position.X, MainModule.GodModeOrigY, rp.Position.Z)) end end end MainModule.GodModeOrigY = nil end PlayToggleSound() return true end MainModule.RageAutoQTEEnabled = false MainModule.RageAutoQTELoop = nil MainModule.toggle_rage_auto_qte = function(enabled) local toggleRef = MainModule.ToggleRefs.RageAutoQTE if enabled then if MainModule.is_xeno_executor() then MainModule.notify("RAGE Auto QTE", "Not supported in your executor", 0.9) PlayErrorSound() if toggleRef and toggleRef.SetValue then pcall(function() toggleRef:SetValue(false) end) end return false end end MainModule.RageAutoQTEEnabled = enabled if MainModule.RageAutoQTELoop then task.cancel(MainModule.RageAutoQTELoop) MainModule.RageAutoQTELoop = nil end if enabled then MainModule.RageAutoQTELoop = task.spawn(function() local QTE = nil local success, module = pcall(function() return require(ReplicatedStorage:WaitForChild("Modules"):WaitForChild("HBGQTE")) end) if success then QTE = module else MainModule.notify("RAGE Auto QTE", "Failed to load QTE module", 0.9) PlayErrorSound() MainModule.RageAutoQTEEnabled = false if toggleRef and toggleRef.SetValue then pcall(function() toggleRef:SetValue(false) end) end return end while MainModule.RageAutoQTEEnabled do task.wait(0.05) pcall(function() if QTE and QTE.ActiveButtons then for _, data in pairs(QTE.ActiveButtons) do if data and data.Inner and data.Outer and not data.Inner:GetAttribute("Tweening") and not data.Inner:GetAttribute("Failed") then pcall(function() QTE.Pressed(false, data) end) end end end end) end end) PlayToggleSound() else PlayToggleSound() end return true end MainModule.RemoveInjuryEnabled = false MainModule.RemoveInjuryConn = nil local injury_names = { Stun=true, stunned=true, Stunned=true, crawl=true, Crawl=true, crawled=true, Crawled=true, crawling=true, Crawling=true, } local function clear_injury_fx() local char = LocalPlayer.Character if not char then return end for _, obj in ipairs(char:GetDescendants()) do local n = obj.Name if injury_names[n] then pcall(function() obj:Destroy() end) end end local hum = char:FindFirstChildOfClass("Humanoid") if hum then pcall(function() for _, t in ipairs(hum:GetPlayingAnimationTracks()) do local id = t.Animation and t.Animation.AnimationId or "" end end) end end MainModule.remove_injury_objects = function() clear_injury_fx() end MainModule.toggle_remove_injury = function(enabled) MainModule.RemoveInjuryEnabled = enabled and true or false if MainModule.RemoveInjuryConn then pcall(function() MainModule.RemoveInjuryConn:Disconnect() end) MainModule.RemoveInjuryConn = nil end if MainModule.RemoveInjuryEnabled then clear_injury_fx() MainModule.RemoveInjuryConn = RunService.Heartbeat:Connect(function() if not MainModule.RemoveInjuryEnabled then return end if not MainModule._injury_last then MainModule._injury_last = 0 end if tick() - MainModule._injury_last < 1 then return end MainModule._injury_last = tick() clear_injury_fx() end) end PlayToggleSound() end MainModule = MainModule or {} MainModule.FireHotbarTool = function(toolName) local lp = Players.LocalPlayer if not lp then return false end local backpack = lp:FindFirstChild("Backpack") if not backpack then return false end local item = backpack:FindFirstChild(toolName) if not item then local ch = lp.Character item = ch and ch:FindFirstChild(toolName) end if not item then return false end local hotbar = lp.PlayerGui:FindFirstChild("Hotbar") if not hotbar then return false end local hb = hotbar:FindFirstChild("Backpack") hb = hb and hb:FindFirstChild("Hotbar") if not hb then return false end local button = nil for _, slot in pairs(hb:GetChildren()) do local tn = slot:FindFirstChild("ToolName") if tn and tn.Text == toolName then button = slot break end end if not button or not getconnections then return false end pcall(function() for _, connection in pairs(getconnections(button.MouseButton1Down)) do pcall(function() connection:Fire() end) end task.wait(0.05) for _, connection in pairs(getconnections(button.MouseButton1Up)) do pcall(function() connection:Fire() end) end end) return true end loadstring([[ function LPH_NO_VIRTUALIZE(f) return f end; ]])(); MainModule = MainModule or {} --@encrypt_start loadstring([[ function LPH_NO_VIRTUALIZE(f) return f end; ]])(); function MainModule.EnsureFakeUltraInstinct() if type(MainModule.FakeUltraInstinct) ~= "table" then MainModule.FakeUltraInstinct = {} end local FUI = MainModule.FakeUltraInstinct if FUI.MaxDodges == nil then FUI.MaxDodges = 10 end if FUI.Dodges == nil then FUI.Dodges = 10 end if FUI.Cooldown == nil then FUI.Cooldown = false end if FUI.Equipped == nil then FUI.Equipped = false end if FUI.AnimPlaying == nil then FUI.AnimPlaying = false end if FUI.Enabled == nil then FUI.Enabled = false end if FUI.SoundId == nil then FUI.SoundId = "rbxassetid://6732929006" end if type(FUI.DodgeLabels) ~= "table" then FUI.DodgeLabels = {} end if type(FUI.Connections) ~= "table" then FUI.Connections = {} end if type(FUI.FXMap) ~= "table" then FUI.FXMap = { [1] = 1, [2] = 2, [3] = 1, [4] = 2, [5] = 1 } end return FUI end function MainModule.FUIGetPlayer() return game:GetService("Players").LocalPlayer end function MainModule.FUIGetEffects() local FUI = MainModule.EnsureFakeUltraInstinct() if FUI.UIDodgeEffects then return FUI.UIDodgeEffects end local ok, result = pcall(function() local rs = game:GetService("ReplicatedStorage") local modules = rs:FindFirstChild("Modules") if not modules then return nil end local abilityModules = modules:FindFirstChild("AbilityEffectsModules") if not abilityModules then return nil end local target = abilityModules:FindFirstChild("UIDodgeCLIENTEFFECTS") if not target then return nil end return require(target) end) if ok and type(result) == "function" then FUI.UIDodgeEffects = result return result end return nil end function MainModule.FUIGetAnimFolder() local FUI = MainModule.EnsureFakeUltraInstinct() if FUI.AnimFolder and FUI.AnimFolder.Parent then return FUI.AnimFolder end local ok, result = pcall(function() local rs = game:GetService("ReplicatedStorage") local animations = rs:FindFirstChild("Animations") if not animations then return nil end local abilities = animations:FindFirstChild("Abilities") if not abilities then return nil end return abilities:FindFirstChild("UltraInstinct") end) if ok and result then FUI.AnimFolder = result return result end return nil end function MainModule.FUIGetChar() local player = MainModule.FUIGetPlayer() if not player then return nil end return player.Character end function MainModule.FUIGetAnimator() local char = MainModule.FUIGetChar() if not char then return nil end local humanoid = char:FindFirstChildOfClass("Humanoid") if not humanoid then return nil end local animator = humanoid:FindFirstChildOfClass("Animator") if not animator then animator = Instance.new("Animator") animator.Parent = humanoid end return animator end function MainModule.FUIGetAnimations() local folder = MainModule.FUIGetAnimFolder() if not folder then return {} end local list = {} for _, obj in ipairs(folder:GetChildren()) do if obj:IsA("Animation") and obj.AnimationId ~= "" then table.insert(list, obj) end end return list end function MainModule.FUIStageOf(anim) if not anim then return 1 end return tonumber(tostring(anim.Name):match("%d+")) or 1 end function MainModule.FUIPlayAura() local effects = MainModule.FUIGetEffects() if not effects then return end local char = MainModule.FUIGetChar() if not char then return end pcall(function() effects({ ModuleName = "UIDodge", Character = char, initial = true }) end) end function MainModule.FUIPlayDodgeFX(stage) local effects = MainModule.FUIGetEffects() if not effects then return end local char = MainModule.FUIGetChar() if not char then return end pcall(function() effects({ ModuleName = "UIDodge", Character = char, dodgenumber = stage, initial = false }) end) end function MainModule.FUIPlaySound() local FUI = MainModule.EnsureFakeUltraInstinct() local char = MainModule.FUIGetChar() if not char then return end local root = char:FindFirstChild("HumanoidRootPart") or char:FindFirstChild("Head") if not root then return end local sound = Instance.new("Sound") sound.Name = "FakeUltraInstinctSound" sound.SoundId = FUI.SoundId sound.Volume = 1.5 sound.RollOffMaxDistance = 120 sound.Parent = root pcall(function() sound:Play() end) sound.Ended:Once(function() sound:Destroy() end) end function MainModule.FUIFindLabels(root) local labels = {} if not root then return labels end for _, obj in ipairs(root:GetDescendants()) do if obj:IsA("TextLabel") or obj:IsA("TextButton") then local text = tostring(obj.Text) if text:find("%d+%s*/%s*%d+") or text:lower():find("dodge") then table.insert(labels, obj) end end end return labels end function MainModule.FUISetupPanel() local FUI = MainModule.EnsureFakeUltraInstinct() if FUI.Panel and FUI.Panel.Parent then return end local player = MainModule.FUIGetPlayer() if not player then return end local playerGui = player:FindFirstChild("PlayerGui") if not playerGui then return end local original = playerGui:FindFirstChild("PowerUIDodges") if not original then return end FUI.OriginalPanel = original pcall(function() if original:IsA("ScreenGui") then original.Enabled = false end end) local clone = original:Clone() clone.Name = "FakeUltraInstinctDodges" for _, obj in ipairs(clone:GetDescendants()) do if obj:IsA("LocalScript") or obj:IsA("Script") then obj:Destroy() end end local parent = playerGui if type(gethui) == "function" then local ok, hui = pcall(gethui) if ok and hui then parent = hui end end clone.Parent = parent if clone:IsA("ScreenGui") then clone.Enabled = true clone.ResetOnSpawn = false end FUI.Panel = clone FUI.DodgeLabels = MainModule.FUIFindLabels(clone) MainModule.FUIUpdatePanel() end function MainModule.FUIUpdatePanel() local FUI = MainModule.EnsureFakeUltraInstinct() if not FUI.Panel or not FUI.Panel.Parent then return end local text = string.format("Dodges Left: %d/%d", FUI.Dodges, FUI.MaxDodges) for _, label in ipairs(FUI.DodgeLabels) do if label and label.Parent then pcall(function() label.Text = text end) end end end function MainModule.FUIConsumeDodge() local FUI = MainModule.EnsureFakeUltraInstinct() FUI.Dodges = math.max(FUI.Dodges - 1, 0) MainModule.FUIUpdatePanel() if FUI.Dodges <= 0 then task.delay(0.35, function() local inner = MainModule.EnsureFakeUltraInstinct() if not inner.Enabled then return end inner.Dodges = inner.MaxDodges MainModule.FUIUpdatePanel() end) end end function MainModule.FUIStopAnim() local FUI = MainModule.EnsureFakeUltraInstinct() if FUI.CurrentTrack then pcall(function() FUI.CurrentTrack:Stop(0.1) FUI.CurrentTrack:Destroy() end) end FUI.CurrentTrack = nil FUI.AnimPlaying = false end function MainModule.FUIPlayAll(consume) local FUI = MainModule.EnsureFakeUltraInstinct() if not FUI.Enabled then return end local list = MainModule.FUIGetAnimations() if #list == 0 then return end local selected if #list == 1 then selected = list[1] else local tries = 0 repeat selected = list[math.random(1, #list)] tries += 1 until selected ~= FUI.LastAnim or tries > 10 end FUI.LastAnim = selected local stage = MainModule.FUIStageOf(selected) local fxStage = FUI.FXMap[stage] or math.random(1, 2) MainModule.FUIStopAnim() local animator = MainModule.FUIGetAnimator() if animator then local ok, track = pcall(function() return animator:LoadAnimation(selected) end) if ok and track then FUI.AnimPlaying = true FUI.CurrentTrack = track track.Priority = Enum.AnimationPriority.Action4 track.Looped = false pcall(function() track:Play(0.05, 1, 1) end) track.Stopped:Once(function() local inner = MainModule.EnsureFakeUltraInstinct() if inner.CurrentTrack == track then pcall(function() track:Destroy() end) inner.CurrentTrack = nil inner.AnimPlaying = false end end) end end task.spawn(MainModule.FUIPlayAura) task.spawn(function() MainModule.FUIPlayDodgeFX(fxStage) end) task.spawn(MainModule.FUIPlaySound) if consume then MainModule.FUIConsumeDodge() end end function MainModule.FUIDoDodge() local FUI = MainModule.EnsureFakeUltraInstinct() if not FUI.Enabled then return end if FUI.Cooldown then return end FUI.Cooldown = true MainModule.FUIPlayAll(true) task.delay(0.35, function() local inner = MainModule.EnsureFakeUltraInstinct() inner.Cooldown = false end) end function MainModule.FUICreateTool() local FUI = MainModule.EnsureFakeUltraInstinct() if not FUI.Enabled then return end if FUI.Tool and FUI.Tool.Parent then return end local player = MainModule.FUIGetPlayer() if not player then return end local backpack = player:FindFirstChildOfClass("Backpack") or player:WaitForChild("Backpack", 5) if not backpack then return end local existing = backpack:FindFirstChild("Ultra Instinct") or (player.Character and player.Character:FindFirstChild("Ultra Instinct")) if existing then pcall(function() existing:Destroy() end) end local tool = Instance.new("Tool") tool.Name = "Ultra Instinct" tool.RequiresHandle = false tool.CanBeDropped = false tool.ToolTip = "Ultra Instinct" tool.Parent = backpack FUI.Tool = tool table.insert(FUI.Connections, tool.Equipped:Connect(function() local inner = MainModule.EnsureFakeUltraInstinct() if not inner.Enabled then return end inner.Equipped = true MainModule.FUISetupPanel() task.wait(0.1) MainModule.FUIDoDodge() end)) table.insert(FUI.Connections, tool.Unequipped:Connect(function() local inner = MainModule.EnsureFakeUltraInstinct() inner.Equipped = false MainModule.FUIStopAnim() end)) table.insert(FUI.Connections, tool.Activated:Connect(function() task.wait(0.2) MainModule.FUIDoDodge() end)) end function MainModule.FUIDestroy() local FUI = MainModule.EnsureFakeUltraInstinct() FUI.Enabled = false FUI.Equipped = false FUI.Cooldown = false MainModule.FUIStopAnim() for _, connection in ipairs(FUI.Connections) do pcall(function() connection:Disconnect() end) end table.clear(FUI.Connections) if FUI.Tool then pcall(function() FUI.Tool:Destroy() end) FUI.Tool = nil end if FUI.Panel then pcall(function() FUI.Panel:Destroy() end) FUI.Panel = nil end if FUI.OriginalPanel then pcall(function() if FUI.OriginalPanel:IsA("ScreenGui") then FUI.OriginalPanel.Enabled = true end end) FUI.OriginalPanel = nil end FUI.DodgeLabels = {} FUI.Dodges = FUI.MaxDodges end function MainModule.toggle_fake_ultra_instinct(enabled) local FUI = MainModule.EnsureFakeUltraInstinct() enabled = enabled == true if enabled then if FUI.Enabled then return end FUI.Enabled = true FUI.Dodges = FUI.MaxDodges MainModule.FUICreateTool() else MainModule.FUIDestroy() end end do local FUI = MainModule.EnsureFakeUltraInstinct() if FUI.CharacterConnection then pcall(function() FUI.CharacterConnection:Disconnect() end) end local player = MainModule.FUIGetPlayer() if player then FUI.CharacterConnection = player.CharacterAdded:Connect(function() task.wait(1) local inner = MainModule.EnsureFakeUltraInstinct() inner.Equipped = false inner.Cooldown = false inner.AnimPlaying = false inner.Dodges = inner.MaxDodges inner.Tool = nil inner.Panel = nil inner.DodgeLabels = {} MainModule.FUIStopAnim() if inner.Enabled then MainModule.FUICreateTool() end end) end end --@encrypt_end MainModule.PhantomDashEnabled = false MainModule.PhantomDashKeybind = Enum.KeyCode.Q MainModule.PhantomDashDistance = 15 MainModule.PhantomDashDuration = 0.25 MainModule.PhantomDashCooldown = 1 MainModule.PhantomDashMaxCharges = 2 MainModule.PhantomDashCurrentCharges = 2 MainModule.PhantomDashIsMoving = false MainModule.PhantomDashSoundId = "rbxassetid://94904871279766" MainModule.PhantomDashBackwardSoundId = "rbxassetid://99068532205349" MainModule.PhantomDashTextures = { "http://www.roblox.com/asset/?id=122158926856615", "http://www.roblox.com/asset/?id=14005913529", "http://www.roblox.com/asset/?id=17888919056", "http://www.roblox.com/asset/?id=14695179076", "http://www.roblox.com/asset/?id=15431126240", "http://www.roblox.com/asset/?id=14045123768" } MainModule.PhantomDashConnection = nil MainModule.PhantomDashKeybindConnection = nil MainModule.PhantomDashMobileGui = nil MainModule.PhantomDashRechargeThread = nil local function createDiagonalClusterTrail(parent) local createdEmitters = {} for index, textureId in ipairs(MainModule.PhantomDashTextures) do local emitter = Instance.new("ParticleEmitter") emitter.Name = "DashDiagonalCluster_" .. index emitter.Texture = textureId emitter.Color = ColorSequence.new(Color3.new(0, 0, 0)) emitter.LightEmission = 0 emitter.LightInfluence = 0 emitter.Brightness = 1 emitter.LockedToPart = false emitter.Orientation = Enum.ParticleOrientation.FacingCamera emitter.Rotation = NumberRange.new(45, 45) emitter.RotSpeed = NumberRange.new(0, 0) emitter.Speed = NumberRange.new(1, 5) emitter.SpreadAngle = Vector2.new(20, 20) emitter.Lifetime = NumberRange.new(0.3, 0.6) emitter.ZOffset = 1 emitter.Size = NumberSequence.new({ NumberSequenceKeypoint.new(0, 3.5), NumberSequenceKeypoint.new(0.5, 6), NumberSequenceKeypoint.new(1, 0) }) emitter.Transparency = NumberSequence.new({ NumberSequenceKeypoint.new(0, 0), NumberSequenceKeypoint.new(0.6, 0.4), NumberSequenceKeypoint.new(1, 1) }) emitter.Parent = parent table.insert(createdEmitters, emitter) end return createdEmitters end local function startRecharge() if MainModule.PhantomDashRechargeThread then task.cancel(MainModule.PhantomDashRechargeThread) end MainModule.PhantomDashRechargeThread = task.spawn(function() while MainModule.PhantomDashCurrentCharges < MainModule.PhantomDashMaxCharges do task.wait(MainModule.PhantomDashCooldown) MainModule.PhantomDashCurrentCharges = math.min(MainModule.PhantomDashMaxCharges, MainModule.PhantomDashCurrentCharges + 1) end MainModule.PhantomDashRechargeThread = nil end) end local function doPhantomDash() if MainModule.PhantomDashIsMoving or MainModule.PhantomDashCurrentCharges <= 0 then return end local character = MainModule.get_character() if not character then return end local hrp = MainModule.get_root_part(character) local humanoid = MainModule.get_humanoid(character) if not hrp or not humanoid then return end MainModule.PhantomDashIsMoving = true local shouldStartRecharge = (MainModule.PhantomDashCurrentCharges == MainModule.PhantomDashMaxCharges) MainModule.PhantomDashCurrentCharges = MainModule.PhantomDashCurrentCharges - 1 if shouldStartRecharge then startRecharge() end local moveDir = humanoid.MoveDirection local isMovingBackward = false local dashDirectionVector = hrp.CFrame.LookVector if moveDir.Magnitude > 0 then local dot = moveDir:Dot(hrp.CFrame.LookVector) if dot < -0.2 or UserInputService:IsKeyDown(Enum.KeyCode.S) then isMovingBackward = true dashDirectionVector = -hrp.CFrame.LookVector else dashDirectionVector = moveDir end elseif UserInputService:IsKeyDown(Enum.KeyCode.S) then isMovingBackward = true dashDirectionVector = -hrp.CFrame.LookVector end local soundToPlay = isMovingBackward and MainModule.PhantomDashBackwardSoundId or MainModule.PhantomDashSoundId local sound = Instance.new("Sound") sound.SoundId = soundToPlay sound.Volume = 1.5 sound.Parent = hrp sound:Play() task.delay(3, function() sound:Destroy() end) local emitters = createDiagonalClusterTrail(hrp) for _, emitter in ipairs(emitters) do emitter.Rate = 110 emitter.Enabled = true end local targetCFrame = hrp.CFrame + (dashDirectionVector * MainModule.PhantomDashDistance) local tweenInfo = TweenInfo.new(MainModule.PhantomDashDuration, Enum.EasingStyle.Quad, Enum.EasingDirection.Out) local tween = TweenService:Create(hrp, tweenInfo, {CFrame = targetCFrame}) tween:Play() task.wait(MainModule.PhantomDashDuration) for _, emitter in ipairs(emitters) do emitter.Enabled = false task.delay(1.2, function() emitter:Destroy() end) end MainModule.PhantomDashIsMoving = false end local function createMobilePhantomDashButton() if MainModule.PhantomDashMobileGui then MainModule.PhantomDashMobileGui:Destroy() MainModule.PhantomDashMobileGui = nil end local playerGui = LocalPlayer:FindFirstChild("PlayerGui") if not playerGui then return end local screenGui = Instance.new("ScreenGui") screenGui.Name = HttpService:GenerateGUID(false) screenGui.ResetOnSpawn = false screenGui.Parent = playerGui local dashButton = Instance.new("TextButton") dashButton.Name = HttpService:GenerateGUID(false) dashButton.Size = UDim2.new(0, 70, 0, 70) dashButton.Position = UDim2.new(0.8, -35, 0.6, -35) dashButton.BackgroundColor3 = Color3.fromRGB(0, 0, 0) dashButton.Text = "Dash" dashButton.TextColor3 = Color3.fromRGB(255, 255, 255) dashButton.Font = Enum.Font.GothamBold dashButton.TextSize = 16 dashButton.Active = true dashButton.Parent = screenGui local uiCorner = Instance.new("UICorner") uiCorner.CornerRadius = UDim.new(0, 12) uiCorner.Parent = dashButton local uiStroke = Instance.new("UIStroke") uiStroke.Thickness = 2 uiStroke.Color = Color3.fromRGB(0, 0, 0) uiStroke.ApplyStrokeMode = Enum.ApplyStrokeMode.Contextual uiStroke.Parent = dashButton local dragging = false local dragStart, startPos local hasMoved = false dashButton.InputBegan:Connect(function(input) if input.UserInputType == Enum.UserInputType.Touch or input.UserInputType == Enum.UserInputType.MouseButton1 then dragging = true hasMoved = false dragStart = input.Position startPos = dashButton.Position input.Changed:Connect(function() if input.UserInputState == Enum.UserInputState.End then dragging = false end end) end end) dashButton.InputChanged:Connect(function(input) if dragging and (input.UserInputType == Enum.UserInputType.Touch or input.UserInputType == Enum.UserInputType.MouseMovement) then local delta = input.Position - dragStart if delta.Magnitude > 5 then hasMoved = true end dashButton.Position = UDim2.new( startPos.X.Scale, startPos.X.Offset + delta.X, startPos.Y.Scale, startPos.Y.Offset + delta.Y ) end end) dashButton.MouseButton1Click:Connect(function() if not hasMoved then doPhantomDash() end end) MainModule.PhantomDashMobileGui = screenGui end function MainModule.toggle_phantom_dash(enabled) MainModule.PhantomDashEnabled = enabled if MainModule.PhantomDashConnection then MainModule.PhantomDashConnection:Disconnect() MainModule.PhantomDashConnection = nil end if MainModule.PhantomDashKeybindConnection then MainModule.PhantomDashKeybindConnection:Disconnect() MainModule.PhantomDashKeybindConnection = nil end if MainModule.PhantomDashMobileGui then MainModule.PhantomDashMobileGui:Destroy() MainModule.PhantomDashMobileGui = nil end if MainModule.PhantomDashRechargeThread then task.cancel(MainModule.PhantomDashRechargeThread) MainModule.PhantomDashRechargeThread = nil end MainModule.PhantomDashCurrentCharges = MainModule.PhantomDashMaxCharges MainModule.PhantomDashIsMoving = false if enabled then if MainModule.is_mobile() then createMobilePhantomDashButton() else MainModule.PhantomDashKeybindConnection = UserInputService.InputBegan:Connect(function(input, gameProcessed) if gameProcessed then return end if input.KeyCode == MainModule.PhantomDashKeybind then doPhantomDash() end end) end end PlayToggleSound() end function MainModule.set_phantom_dash_keybind(keycode) MainModule.PhantomDashKeybind = keycode end function MainModule.set_phantom_dash_distance(value) MainModule.PhantomDashDistance = value end function MainModule.set_phantom_dash_duration(value) MainModule.PhantomDashDuration = value / 100 end function MainModule.set_phantom_dash_cooldown(value) MainModule.PhantomDashCooldown = value end function MainModule.set_phantom_dash_max_charges(value) MainModule.PhantomDashMaxCharges = value MainModule.PhantomDashCurrentCharges = value end MainModule.RLGLEnabled = false MainModule.RLGLConnection = nil MainModule.RLGLOriginalWalkSpeed = 16 MainModule.RLGLOriginalJumpPower = 50 MainModule.RLGLOriginalJumpHeight = 7.2 MainModule.RLGLWasFrozen = false MainModule.RLGLRedLightAnimId = "rbxassetid://73083130944511" MainModule.RLGLPointA = Vector3.new(-215, 1023, -513) MainModule.RLGLPointB = Vector3.new(116, 1023, 82) MainModule.RLGLMinX = math.min(MainModule.RLGLPointA.X, MainModule.RLGLPointB.X) MainModule.RLGLMaxX = math.max(MainModule.RLGLPointA.X, MainModule.RLGLPointB.X) MainModule.RLGLMinY = math.min(MainModule.RLGLPointA.Y, MainModule.RLGLPointB.Y) - 50 MainModule.RLGLMaxY = math.max(MainModule.RLGLPointA.Y, MainModule.RLGLPointB.Y) + 50 MainModule.RLGLMinZ = math.min(MainModule.RLGLPointA.Z, MainModule.RLGLPointB.Z) MainModule.RLGLMaxZ = math.max(MainModule.RLGLPointA.Z, MainModule.RLGLPointB.Z) pcall(function() local anim = ReplicatedStorage:FindFirstChild("Animations") and ReplicatedStorage.Animations:FindFirstChild("Games") and ReplicatedStorage.Animations.Games:FindFirstChild("RedLightGreenLight") and ReplicatedStorage.Animations.Games.RedLightGreenLight:FindFirstChild("RedLightTurn") if anim and anim:IsA("Animation") then MainModule.RLGLRedLightAnimId = anim.AnimationId end end) function MainModule.getHumanoid() local char = LocalPlayer.Character return char and char:FindFirstChildOfClass("Humanoid") end function MainModule.getHRP() local char = LocalPlayer.Character return char and char:FindFirstChild("HumanoidRootPart") end function MainModule.isPlayerInZone() local hrp = MainModule.getHRP() if not hrp then return false end local pos = hrp.Position return (pos.X >= MainModule.RLGLMinX and pos.X <= MainModule.RLGLMaxX) and (pos.Y >= MainModule.RLGLMinY and pos.Y <= MainModule.RLGLMaxY) and (pos.Z >= MainModule.RLGLMinZ and pos.Z <= MainModule.RLGLMaxZ) end MainModule.RLGLCachedAnimators = {} MainModule.RLGLLastCacheTime = 0 function MainModule.updateAnimatorCache() local currentTime = tick() if currentTime - MainModule.RLGLLastCacheTime < 0.5 then return end MainModule.RLGLLastCacheTime = currentTime table.clear(MainModule.RLGLCachedAnimators) for _, obj in ipairs(Workspace:GetDescendants()) do if obj:IsA("Animator") then table.insert(MainModule.RLGLCachedAnimators, obj) end end end function MainModule.isRedLightActive() MainModule.updateAnimatorCache() local targetId = tostring(MainModule.RLGLRedLightAnimId) for i = #MainModule.RLGLCachedAnimators, 1, -1 do local animator = MainModule.RLGLCachedAnimators[i] if not animator or not animator.Parent then table.remove(MainModule.RLGLCachedAnimators, i) else for _, track in ipairs(animator:GetPlayingAnimationTracks()) do if track.Animation and track.IsPlaying then local animId = tostring(track.Animation.AnimationId) if animId == targetId then return true end end end end end return false end function MainModule.freezePlayer() local humanoid = MainModule.getHumanoid() local hrp = MainModule.getHRP() if not humanoid then return end if not MainModule.RLGLWasFrozen then MainModule.RLGLOriginalWalkSpeed = humanoid.WalkSpeed MainModule.RLGLOriginalJumpPower = humanoid.JumpPower MainModule.RLGLOriginalJumpHeight = humanoid.JumpHeight MainModule.RLGLWasFrozen = true end humanoid:Move(Vector3.new(0, 0, 0), false) if hrp then hrp.AssemblyLinearVelocity = Vector3.new(0, hrp.AssemblyLinearVelocity.Y, 0) hrp.AssemblyAngularVelocity = Vector3.new(0, 0, 0) end humanoid.WalkSpeed = 0 humanoid.JumpPower = 0 humanoid.JumpHeight = 0 end function MainModule.unfreezePlayer() local humanoid = MainModule.getHumanoid() if not humanoid then return end humanoid.WalkSpeed = MainModule.RLGLOriginalWalkSpeed > 0 and MainModule.RLGLOriginalWalkSpeed or 16 humanoid.JumpPower = MainModule.RLGLOriginalJumpPower > 0 and MainModule.RLGLOriginalJumpPower or 50 humanoid.JumpHeight = MainModule.RLGLOriginalJumpHeight > 0 and MainModule.RLGLOriginalJumpHeight or 7.2 MainModule.RLGLWasFrozen = false end function MainModule.toggle_rlgl_stop(enabled) MainModule.RLGLEnabled = enabled if MainModule.RLGLConnection then MainModule.RLGLConnection:Disconnect() MainModule.RLGLConnection = nil end if enabled then MainModule.RLGLConnection = RunService.Heartbeat:Connect(function() if not MainModule.RLGLEnabled then return end if MainModule.isPlayerInZone() and MainModule.isRedLightActive() then MainModule.freezePlayer() else if MainModule.RLGLWasFrozen then MainModule.unfreezePlayer() end end end) else if MainModule.RLGLWasFrozen then MainModule.unfreezePlayer() end end if PlayToggleSound then PlayToggleSound() end end MainModule.TugOfWarQTEMode = false MainModule.TugOfWarQTEConnection = nil MainModule.TugOfWarQTEUI = nil local qte = nil pcall(function() qte = require(ReplicatedStorage:WaitForChild("Modules", 5):WaitForChild("HBGQTE", 5)) end) local function findTugOfWarUI() local playerGui = LocalPlayer:FindFirstChild("PlayerGui") if not playerGui then return nil end local ui = playerGui:FindFirstChild("TugOfWarUIV2") or playerGui:FindFirstChild("TugOfWarUI") or playerGui:FindFirstChild("TugofWarRemake") if ui then return ui end local storage = ReplicatedStorage:FindFirstChild("UI") if storage then ui = storage:FindFirstChild("TugOfWarUIV2") or storage:FindFirstChild("TugOfWarUI") if ui then local clone = ui:Clone() clone.Parent = playerGui return clone end end return nil end function MainModule.toggle_tug_of_war_qte(enabled) MainModule.TugOfWarQTEMode = enabled if MainModule.TugOfWarQTEConnection then MainModule.TugOfWarQTEConnection:Disconnect() MainModule.TugOfWarQTEConnection = nil end if MainModule.TugOfWarQTEUI then MainModule.TugOfWarQTEUI:Destroy() MainModule.TugOfWarQTEUI = nil end if enabled then LocalPlayer:SetAttribute("TugOfWarPhase", "QTE") workspace:SetAttribute("TugOfWarRhythmGoal", 180) workspace:SetAttribute("TugOfWarRush", nil) local ui = findTugOfWarUI() if ui then ui.Enabled = true MainModule.TugOfWarQTEUI = ui local handler = ui:FindFirstChild("TugOfWarQTEHandler", true) or ui:FindFirstChildWhichIsA("LocalScript", true) or ui:FindFirstChildWhichIsA("Script", true) if handler and handler:IsA("LocalScript") then handler.Disabled = false end end task.wait(0.3) LocalPlayer:SetAttribute("TugOfWarPhase", "QTE") MainModule.notify("Tug of War", "QTE Mode Enabled", 0.9) else MainModule.notify("Tug of War", "QTE Mode Disabled", 0.9) end PlayToggleSound() end local qteButtonsRunning = false local qteButtonsTask = nil local function StopQTEButtons() qteButtonsRunning = false if qteButtonsTask then task.cancel(qteButtonsTask) qteButtonsTask = nil end end MainModule.QTELetters = MainModule.QTELetters or "WASD" MainModule.QTESpawnSpeed = MainModule.QTESpawnSpeed or 0.5 local function StartQTEButtons() StopQTEButtons() local letters = MainModule.QTELetters or "WASD" local speed = tonumber(MainModule.QTESpawnSpeed) or 0.5 local filtered = {} for i = 1, #tostring(letters) do local char = tostring(letters):sub(i, i):upper() if char:match("[A-Z]") then filtered[#filtered + 1] = char end end if #filtered == 0 then HSXNotify("QTE Buttons", "No valid letters entered", 0.9) return end local qteMod = qte if not qteMod then pcall(function() local mods = ReplicatedStorage:FindFirstChild("Modules") if mods then local m = mods:FindFirstChild("HBGQTE") if m then qteMod = require(m) end end end) qte = qteMod end if not qteMod or type(qteMod.SetUpButton) ~= "function" then HSXNotify("QTE Buttons", "HBGQTE not available right now", 0.9) return end qteButtonsRunning = true qteButtonsTask = task.spawn(function() local index = 1 while qteButtonsRunning do local key = filtered[index] local ok, err = pcall(function() qteMod.SetUpButton(3, key, false, nil) end) if not ok then qteButtonsRunning = false break end index = index % #filtered + 1 task.wait(speed) end qteButtonsTask = nil end) end function MainModule.toggle_qte_buttons(enabled) if enabled then StartQTEButtons() else StopQTEButtons() end PlayToggleSound() end MainModule.BalloonData = { ESPEnabled = false, TPEnabled = false, Tracers = {}, Highlights = {}, NotifiedBalloons = {}, ProcessedPrompts = {} } local function firePromptExecutor(prompt) if not prompt or not prompt:IsA("ProximityPrompt") then return end if fireproximityprompt then pcall(function() fireproximityprompt(prompt) end) elseif syn and syn.proximityprompt then pcall(function() syn.proximityprompt(prompt) end) else local originalDuration = prompt.HoldDuration prompt.HoldDuration = 0 pcall(function() prompt:InputHoldBegin() task.wait() prompt:InputHoldEnd() end) prompt.HoldDuration = originalDuration end end function MainModule.toggle_balloon_teleport(enabled) MainModule.BalloonData.TPEnabled = enabled end local function isPromptClaimable(prompt) if not prompt or not prompt:IsA("ProximityPrompt") then return false end if not prompt.Enabled then return false end if not prompt.Parent then return false end if prompt.MaxActivationDistance and prompt.MaxActivationDistance <= 0 then return false end return true end task.spawn(function() while task.wait(0.2) do if MainModule.BalloonData.TPEnabled then local effects = workspace:FindFirstChild("Effects") if effects then for _, balloon in ipairs(effects:GetChildren()) do if balloon.Name == "Balloon" and not MainModule.BalloonData.ProcessedPrompts[balloon] then local prompt = balloon:FindFirstChild("BalloonProximityPrompt", true) or balloon:FindFirstChildWhichIsA("ProximityPrompt", true) if prompt and isPromptClaimable(prompt) then MainModule.BalloonData.ProcessedPrompts[balloon] = true task.spawn(function() if not (balloon and balloon.Parent and MainModule.BalloonData.TPEnabled) then return end if not isPromptClaimable(prompt) then MainModule.BalloonData.ProcessedPrompts[balloon] = nil return end local targetPart = prompt.Parent:IsA("BasePart") and prompt.Parent or balloon:FindFirstChildWhichIsA("BasePart", true) local char = MainModule.get_character() local hrp = char and MainModule.get_root_part(char) if char and hrp and targetPart then pcall(function() char:PivotTo(targetPart.CFrame * CFrame.new(0, 5, 0)) end) task.wait(0.2) if isPromptClaimable(prompt) then firePromptExecutor(prompt) end else MainModule.BalloonData.ProcessedPrompts[balloon] = nil end end) end end end end end end end) function MainModule.create_esp_visuals(balloon) local targetPart = balloon:IsA("BasePart") and balloon or balloon:FindFirstChildWhichIsA("BasePart", true) if not targetPart then return end if not MainModule.BalloonData.NotifiedBalloons[balloon] then MainModule.BalloonData.NotifiedBalloons[balloon] = true if Library and HSXNotify then HSXNotify({Title = "HollyScriptX", Description = "Balloon detected!", Duration = 0.9}) end if PlayErrorSound then PlayErrorSound() end end if not MainModule.BalloonData.Highlights[balloon] then local highlight = Instance.new("Highlight") highlight.Name = "BalloonHighlight" highlight.Adornee = balloon highlight.FillColor = Color3.fromRGB(255, 255, 255) highlight.OutlineColor = Color3.fromRGB(255, 255, 255) highlight.FillTransparency = 0.5 highlight.OutlineTransparency = 0 highlight.Parent = balloon MainModule.BalloonData.Highlights[balloon] = highlight end local char = MainModule.get_character() if char then local hrp = MainModule.get_root_part(char) if hrp and not MainModule.BalloonData.Tracers[targetPart] then local a0 = Instance.new("Attachment", hrp) a0.Name = "BalloonTracerA0" local a1 = Instance.new("Attachment", targetPart) a1.Name = "BalloonTracerA1" local beam = Instance.new("Beam") beam.Name = "BalloonTracerBeam" beam.Color = ColorSequence.new(Color3.fromRGB(255, 255, 255)) beam.Width0 = 0.15 beam.Width1 = 0.15 beam.FaceCamera = true beam.Attachment0 = a0 beam.Attachment1 = a1 beam.Parent = targetPart MainModule.BalloonData.Tracers[targetPart] = { Attachment0 = a0, Attachment1 = a1, Beam = beam } end end balloon.AncestryChanged:Connect(function(_, parent) if not parent then MainModule.BalloonData.NotifiedBalloons[balloon] = nil MainModule.BalloonData.ProcessedPrompts[balloon] = nil if MainModule.BalloonData.Highlights[balloon] then pcall(function() MainModule.BalloonData.Highlights[balloon]:Destroy() end) MainModule.BalloonData.Highlights[balloon] = nil end if MainModule.BalloonData.Tracers[targetPart] then pcall(function() MainModule.BalloonData.Tracers[targetPart].Attachment0:Destroy() MainModule.BalloonData.Tracers[targetPart].Attachment1:Destroy() MainModule.BalloonData.Tracers[targetPart].Beam:Destroy() end) MainModule.BalloonData.Tracers[targetPart] = nil end end end) end function MainModule.toggle_balloon_esp(enabled) MainModule.BalloonData.ESPEnabled = enabled if not enabled then for balloon, hl in pairs(MainModule.BalloonData.Highlights) do pcall(function() hl:Destroy() end) end for _, data in pairs(MainModule.BalloonData.Tracers) do pcall(function() data.Attachment0:Destroy() data.Attachment1:Destroy() data.Beam:Destroy() end) end MainModule.BalloonData.Highlights = {} MainModule.BalloonData.Tracers = {} MainModule.BalloonData.NotifiedBalloons = {} end end task.spawn(function() while task.wait(0.5) do if MainModule.BalloonData.ESPEnabled then local effects = workspace:FindFirstChild("Effects") if effects then for _, child in ipairs(effects:GetChildren()) do if child.Name == "Balloon" then MainModule.create_esp_visuals(child) end end end end end end) MainModule.noclipEnabled = false MainModule.noclipButton = nil MainModule.noclipConnection = nil MainModule.TELEPORT_DISTANCE = 13 MainModule.RAY_LENGTH = 6 MainModule.createNoclipButton = function() if MainModule.noclipButton then pcall(function() MainModule.noclipButton:Destroy() end) end local screenGui = Instance.new("ScreenGui") screenGui.Name = HttpService:GenerateGUID(false) screenGui.ResetOnSpawn = false screenGui.ZIndexBehavior = Enum.ZIndexBehavior.Sibling screenGui.Parent = LocalPlayer:WaitForChild("PlayerGui") local button = Instance.new("TextButton") button.Name = HttpService:GenerateGUID(false) button.Size = UDim2.new(0, 90, 0, 90) button.Position = UDim2.new(1, -110, 0.5, -45) button.BackgroundColor3 = Color3.fromRGB(15, 15, 18) button.BackgroundTransparency = 0.25 button.Text = "TP Wall" button.TextColor3 = Color3.fromRGB(255, 255, 255) button.TextSize = 16 button.Font = Enum.Font.GothamBold button.AutoButtonColor = true button.Parent = screenGui local stroke = Instance.new("UIStroke") stroke.Color = Color3.fromRGB(200, 200, 210) stroke.Thickness = 1.5 stroke.Parent = button local corner = Instance.new("UICorner") corner.CornerRadius = UDim.new(0, 12) corner.Parent = button local dragging = false local moved = false local dragStart = nil local startPos = nil button.InputBegan:Connect(function(input) if input.UserInputType == Enum.UserInputType.Touch or input.UserInputType == Enum.UserInputType.MouseButton1 then dragging = true moved = false dragStart = input.Position startPos = button.Position end end) UserInputService.InputChanged:Connect(function(input) if not dragging then return end if input.UserInputType == Enum.UserInputType.Touch or input.UserInputType == Enum.UserInputType.MouseMovement then local delta = input.Position - dragStart if math.abs(delta.X) > 6 or math.abs(delta.Y) > 6 then moved = true end button.Position = UDim2.new(startPos.X.Scale, startPos.X.Offset + delta.X, startPos.Y.Scale, startPos.Y.Offset + delta.Y) end end) UserInputService.InputEnded:Connect(function(input) if input.UserInputType == Enum.UserInputType.Touch or input.UserInputType == Enum.UserInputType.MouseButton1 then if dragging and not moved then pcall(function() MainModule.teleportThroughWall() end) end dragging = false end end) MainModule.noclipButton = screenGui return screenGui end MainModule.ThroughWallsEnabled = false MainModule.ThroughWallsConn = nil MainModule.RAY_LENGTH = MainModule.RAY_LENGTH or 50 MainModule.TELEPORT_DISTANCE = MainModule.TELEPORT_DISTANCE or 8 function MainModule.toggle_through_walls(enabled) MainModule.ThroughWallsEnabled = enabled and true or false MainModule.noclipEnabled = MainModule.ThroughWallsEnabled if MainModule.ThroughWallsConn then pcall(function() MainModule.ThroughWallsConn:Disconnect() end) MainModule.ThroughWallsConn = nil end if MainModule.noclipButton then pcall(function() MainModule.noclipButton:Destroy() end) MainModule.noclipButton = nil end if MainModule.ThroughWallsEnabled then MainModule.ThroughWallsConn = UserInputService.InputBegan:Connect(function(input, gp) if gp then return end if input.KeyCode == Enum.KeyCode.X then pcall(function() MainModule.teleportThroughWall() end) end end) local isMobile = false pcall(function() isMobile = UserInputService.TouchEnabled and not UserInputService.KeyboardEnabled end) if isMobile and MainModule.createNoclipButton then pcall(MainModule.createNoclipButton) end end PlayToggleSound() return true end MainModule.teleportThroughWall = function() if not MainModule.noclipEnabled then return end local char = LocalPlayer.Character if not char then return end local root = char:FindFirstChild("HumanoidRootPart") if not root then return end local cam = workspace.CurrentCamera if not cam then return end local direction = cam.CFrame.LookVector local origin = root.Position local rayParams = RaycastParams.new() rayParams.FilterType = Enum.RaycastFilterType.Blacklist rayParams.FilterDescendantsInstances = {char} rayParams.IgnoreWater = true local rayResult = workspace:Raycast(origin, direction * MainModule.RAY_LENGTH, rayParams) local targetPos = origin + (direction * MainModule.TELEPORT_DISTANCE) if rayResult then local hitPos = rayResult.Position local normal = rayResult.Normal targetPos = hitPos + (direction * 3) + (normal * 2) end root.CanCollide = false root.CFrame = CFrame.new(targetPos) task.wait() root.CanCollide = true end MainModule.desyncHooked = false MainModule.desyncAvailable = pcall(function() return raknet and raknet.add_send_hook end) MainModule.rakhook = function(packet) if packet.PacketId == 0x1B then local buf = packet.AsBuffer if buffer and buffer.writeu32 then buffer.writeu32(buf, 1, 0xFFFFFFFF) packet:SetData(buf) end end end MainModule.toggle_desync = function(enabled) local toggleRef = MainModule.ToggleRefs.Desync if enabled and MainModule.is_xeno_executor() then MainModule.notify("Desync", "Not supported in your executor", 0.9) PlayErrorSound() if toggleRef and toggleRef.SetValue then pcall(function() toggleRef:SetValue(false) end) end return false end if not MainModule.desyncAvailable then MainModule.notify("Desync", "Unsupported Executor", 0.9) PlayErrorSound() if toggleRef and toggleRef.SetValue then pcall(function() toggleRef:SetValue(false) end) end return false end if enabled then if not MainModule.desyncHooked then pcall(function() raknet.add_send_hook(MainModule.rakhook) MainModule.desyncHooked = true end) end else if MainModule.desyncHooked then pcall(function() raknet.remove_send_hook(MainModule.rakhook) MainModule.desyncHooked = false end) end end PlayToggleSound() return true end MainModule.PlayerAttachEnabled = false MainModule.attachedTarget = nil MainModule.attachConnection = nil MainModule.autoSearchConnection = nil MainModule.BehindSquare = nil MainModule.FrontSquare = nil MainModule.CurrentSquare = nil MainModule.CurrentBodyVelocity = nil MainModule.AttachConfig = { BehindDistance = 2.5, FrontDistance = 16, SpeedThreshold = 17, MaxSpeed = 500, TransitionSpeed = 150, } MainModule.createSquare = function(name, offsetDistance) local square = Instance.new("Part") square.Name = name square.Size = Vector3.new(3, 0.5, 3) square.Transparency = 1 square.CanCollide = false square.Anchored = true square.Massless = true square.Parent = workspace return square end MainModule.destroySquares = function() if MainModule.BehindSquare then MainModule.BehindSquare:Destroy() MainModule.BehindSquare = nil end if MainModule.FrontSquare then MainModule.FrontSquare:Destroy() MainModule.FrontSquare = nil end end MainModule.isTargetMovingForward = function(targetRoot) if not targetRoot then return false end local targetVel = targetRoot.Velocity local horizontalSpeed = math.sqrt(targetVel.X^2 + targetVel.Z^2) if horizontalSpeed < 2 then return false end local targetLook = targetRoot.CFrame.LookVector local moveDir = Vector3.new(targetVel.X, 0, targetVel.Z).Unit local lookDir = Vector3.new(targetLook.X, 0, targetLook.Z).Unit return lookDir:Dot(moveDir) > 0.7 end MainModule.updateSquares = function(targetRoot) if not targetRoot then return end local targetPos = targetRoot.Position local targetLook = targetRoot.CFrame.LookVector local targetHeight = targetRoot.Position.Y local behindPos = targetPos + (-targetLook * MainModule.AttachConfig.BehindDistance) behindPos = Vector3.new(behindPos.X, targetHeight - 2, behindPos.Z) local frontPos = targetPos + (targetLook * MainModule.AttachConfig.FrontDistance) frontPos = Vector3.new(frontPos.X, targetHeight - 2, frontPos.Z) if MainModule.BehindSquare then MainModule.BehindSquare.Position = behindPos end if MainModule.FrontSquare then MainModule.FrontSquare.Position = frontPos end end MainModule.getTargetSquare = function(targetRoot) if not targetRoot then return MainModule.BehindSquare end local targetVel = targetRoot.Velocity local horizontalSpeed = math.sqrt(targetVel.X^2 + targetVel.Z^2) local isFast = horizontalSpeed > MainModule.AttachConfig.SpeedThreshold local isMovingForward = MainModule.isTargetMovingForward(targetRoot) if isFast and isMovingForward then return MainModule.FrontSquare else return MainModule.BehindSquare end end MainModule.applySmoothMovement = function(targetPos, isTransition) local myChar = LocalPlayer.Character if not myChar then return end local myRoot = myChar:FindFirstChild("HumanoidRootPart") local myHum = myChar:FindFirstChildOfClass("Humanoid") if not myRoot or not myHum then return end if not targetPos then return end local currentPos = myRoot.Position local distance = (targetPos - currentPos).Magnitude if distance > 0.3 then local direction = (targetPos - currentPos).Unit local speed = isTransition and MainModule.AttachConfig.TransitionSpeed or MainModule.AttachConfig.MaxSpeed local moveVector = direction * math.min(speed, distance * 10) if MainModule.CurrentBodyVelocity then MainModule.CurrentBodyVelocity:Destroy() end MainModule.CurrentBodyVelocity = Instance.new("BodyVelocity") MainModule.CurrentBodyVelocity.MaxForce = Vector3.new(50000, 0, 50000) MainModule.CurrentBodyVelocity.Velocity = Vector3.new(moveVector.X, 0, moveVector.Z) MainModule.CurrentBodyVelocity.Parent = myRoot task.wait(0.03) if MainModule.CurrentBodyVelocity then MainModule.CurrentBodyVelocity:Destroy() MainModule.CurrentBodyVelocity = nil end end myHum.AutoRotate = true end MainModule.find_best_target = function() local localPlayer = LocalPlayer if not localPlayer then return nil end local isSeeker = MainModule.is_seeker(localPlayer) local isHider = MainModule.is_hider(localPlayer) local myChar = LocalPlayer.Character if not myChar then return nil end local myRoot = myChar:FindFirstChild("HumanoidRootPart") if not myRoot then return nil end local bestTarget = nil local bestDistance = math.huge for _, player in pairs(Players:GetPlayers()) do if player ~= LocalPlayer and player.Character then local humanoid = player.Character:FindFirstChildOfClass("Humanoid") if humanoid and humanoid.Health > 0 then local valid = false if isSeeker and MainModule.is_hider(player) then valid = true elseif isHider and MainModule.is_seeker(player) then valid = true elseif not isSeeker and not isHider then valid = true end if valid then local targetRoot = player.Character:FindFirstChild("HumanoidRootPart") if targetRoot then local dist = (targetRoot.Position - myRoot.Position).Magnitude if dist < bestDistance then bestDistance = dist bestTarget = player end end end end end end return bestTarget end MainModule.lastSquare = nil MainModule.attachToPlayer = function(targetPlayer) if not targetPlayer or not targetPlayer.Character then return false end if MainModule.attachedTarget == targetPlayer then return true end if MainModule.attachedTarget then MainModule.detach() end local myChar = LocalPlayer.Character if not myChar then return false end local myRoot = myChar:FindFirstChild("HumanoidRootPart") local myHum = myChar:FindFirstChildOfClass("Humanoid") if not myRoot or not myHum then return false end MainModule.destroySquares() MainModule.BehindSquare = MainModule.createSquare("BehindSquare", MainModule.AttachConfig.BehindDistance) MainModule.FrontSquare = MainModule.createSquare("FrontSquare", MainModule.AttachConfig.FrontDistance) MainModule.attachedTarget = targetPlayer MainModule.lastSquare = nil myHum.WalkSpeed = MainModule.AttachConfig.MaxSpeed myHum.AutoRotate = true myHum.PlatformStand = false if not MainModule.FaceTargetModule.Enabled then MainModule.toggle_face_target(true) if MainModule.ToggleRefs.FaceTarget then MainModule.ToggleRefs.FaceTarget:SetValue(true) end end if MainModule.attachConnection then MainModule.attachConnection:Disconnect() end MainModule.attachConnection = RunService.Heartbeat:Connect(function() if not MainModule.PlayerAttachEnabled or not MainModule.attachedTarget then MainModule.detach() return end if not MainModule.attachedTarget or not MainModule.attachedTarget.Character then MainModule.detach() return end local targetChar = MainModule.attachedTarget.Character local targetRoot = targetChar:FindFirstChild("HumanoidRootPart") local targetHum = targetChar:FindFirstChildOfClass("Humanoid") if not targetRoot or not targetHum or targetHum.Health <= 0 then local newTarget = MainModule.find_best_target() if newTarget and newTarget ~= MainModule.attachedTarget then MainModule.attachToPlayer(newTarget) PlayDeathSound() else MainModule.detach() MainModule.notify("KillAura", "No new target's found :c", 0.9) PlayErrorSound() if MainModule.ToggleRefs.PlayerAttach then MainModule.ToggleRefs.PlayerAttach:SetValue(false) end end return end MainModule.updateSquares(targetRoot) local targetSquare = MainModule.getTargetSquare(targetRoot) if targetSquare then local isChangingSquare = (MainModule.lastSquare ~= nil and MainModule.lastSquare ~= targetSquare) local targetPos = targetSquare.Position local targetHeightPos = Vector3.new(targetPos.X, targetPos.Y + 2.5, targetPos.Z) MainModule.applySmoothMovement(targetHeightPos, isChangingSquare) MainModule.lastSquare = targetSquare end end) return true end MainModule.detach = function() if MainModule.attachConnection then MainModule.attachConnection:Disconnect() MainModule.attachConnection = nil end if MainModule.CurrentBodyVelocity then MainModule.CurrentBodyVelocity:Destroy() MainModule.CurrentBodyVelocity = nil end MainModule.destroySquares() local myChar = LocalPlayer.Character if myChar then local myHum = myChar:FindFirstChildOfClass("Humanoid") if myHum then myHum.PlatformStand = false myHum.AutoRotate = true myHum.WalkSpeed = 16 end local myRoot = myChar:FindFirstChild("HumanoidRootPart") if myRoot then myRoot.AssemblyLinearVelocity = Vector3.new(0, 0, 0) end end if MainModule.FaceTargetModule.Enabled then MainModule.toggle_face_target(false) if MainModule.ToggleRefs.FaceTarget then MainModule.ToggleRefs.FaceTarget:SetValue(false) end end MainModule.attachedTarget = nil MainModule.CurrentSquare = nil MainModule.lastSquare = nil end MainModule.startAutoSearch = function() if MainModule.autoSearchConnection then MainModule.autoSearchConnection:Disconnect() end MainModule.autoSearchConnection = RunService.Heartbeat:Connect(function() if not MainModule.PlayerAttachEnabled then return end if MainModule.attachedTarget then return end if tick() % 1 < 0.05 then local bestTarget = MainModule.find_best_target() if bestTarget then MainModule.attachToPlayer(bestTarget) PlayBell() end end end) end MainModule.toggle_player_attach = function(enabled) MainModule.PlayerAttachEnabled = enabled if enabled then local bestTarget = MainModule.find_best_target() if bestTarget then MainModule.attachToPlayer(bestTarget) PlayBell() MainModule.startAutoSearch() else MainModule.notify("Killaura", "No player's found :c", 0.9) PlayErrorSound() MainModule.PlayerAttachEnabled = false if MainModule.ToggleRefs.PlayerAttach then MainModule.ToggleRefs.PlayerAttach:SetValue(false) end end else if MainModule.autoSearchConnection then MainModule.autoSearchConnection:Disconnect() MainModule.autoSearchConnection = nil end MainModule.detach() end PlayToggleSound() end MainModule.spectate_player = function(player) if not player then return end if not player.Character then MainModule.notify("Spectate", "Player has no character", 0.9) PlayErrorSound() return end local hum = player.Character:FindFirstChildOfClass("Humanoid") if not hum or hum.Health <= 0 then HSXNotify({Title = "Spectate", Description = "Player is dead", Duration = 0.9}) PlayErrorSound() return end workspace.CurrentCamera.CameraSubject = hum HSXNotify({Title = "Spectate", Description = "Spectating: " .. player.Name, Duration = 0.9}) PlayBell() end MainModule.stop_spectate = function() local char = LocalPlayer.Character if char then local hum = char:FindFirstChildOfClass("Humanoid") if hum then workspace.CurrentCamera.CameraSubject = hum HSXNotify({Title = "Spectate", Description = "Stopped", Duration = 0.9}) PlayBell() end end end MainModule.teleport_to_player = function(player) if not player then return end if not player.Character then HSXNotify({Title = "Teleport", Description = "Player has no character", Duration = 0.9}) PlayErrorSound() return end local root = player.Character:FindFirstChild("HumanoidRootPart") if not root then HSXNotify({Title = "Teleport", Description = "Player has no root part", Duration = 0.9}) PlayErrorSound() return end local myChar = LocalPlayer.Character if not myChar then return end local myRoot = myChar:FindFirstChild("HumanoidRootPart") if not myRoot then return end myRoot.CFrame = CFrame.new(root.Position + Vector3.new(0, 3, 0)) HSXNotify({Title = "Teleport", Description = "Teleported to: " .. player.Name, Duration = 0.9}) PlayBell() end MainModule.getNearestPlayerAnywhere = function() local nearest = nil local shortest = math.huge local myChar = MainModule.get_character() if not myChar then return nil end local myPos = myChar:FindFirstChild("HumanoidRootPart") and myChar.HumanoidRootPart.Position if not myPos then return nil end for _,p in pairs(Players:GetPlayers()) do if p ~= LocalPlayer and p.Character then local rp = p.Character:FindFirstChild("HumanoidRootPart") if rp then local d = (rp.Position - myPos).Magnitude if d < shortest then shortest = d; nearest = p end end end end return nearest end MainModule.teleportToNearest = function() local nearest = MainModule.getNearestPlayerAnywhere() if nearest and nearest.Character then local root = nearest.Character:FindFirstChild("HumanoidRootPart") if root then local myChar = LocalPlayer.Character if myChar then local myRoot = myChar:FindFirstChild("HumanoidRootPart") if myRoot then myRoot.CFrame = CFrame.new(root.Position + Vector3.new(0, 3, 0)) MainModule.notify("Teleport", "Teleported to: " .. nearest.Name, 0.9) PlayBell() end end end else HSXNotify({Title = "Teleport", Description = "No player's near :c", Duration = 0.9}) PlayErrorSound() end end MainModule.update_all_toggles_by_game = function() local values = Workspace:FindFirstChild("Values") if not values then return end local currentGame = values:FindFirstChild("CurrentGame") local gameName = currentGame and currentGame.Value MainModule.update_toggle_availability("AutoDodge", gameName == "HideAndSeek" and "HideAndSeek" or nil, MainModule.ToggleRefs.AutoDodge) MainModule.update_toggle_availability("InfiniteStamina", gameName == "HideAndSeek" and "HideAndSeek" or nil, MainModule.ToggleRefs.InfiniteStamina) MainModule.update_toggle_availability("SpikesKill", gameName == "HideAndSeek" and "HideAndSeek" or nil, MainModule.ToggleRefs.SpikesKill) MainModule.update_toggle_availability("AutoEscape", gameName == "HideAndSeek" and "HideAndSeek" or nil, MainModule.ToggleRefs.AutoEscape) MainModule.update_toggle_availability("KeyESP", gameName == "HideAndSeek" and "HideAndSeek" or nil, MainModule.ToggleRefs.KeyESP) MainModule.update_toggle_availability("JumpRopeAntiFall", gameName == "JumpRope" and "JumpRope" or nil, MainModule.ToggleRefs.JumpRopeAntiFall) MainModule.update_toggle_availability("GlassESP", gameName == "GlassBridge" and "GlassBridge" or nil, MainModule.ToggleRefs.GlassESP) MainModule.update_toggle_availability("AntiBreak", gameName == "GlassBridge" and "GlassBridge" or nil, MainModule.ToggleRefs.AntiBreak) MainModule.update_toggle_availability("ZoneKill", gameName == "LastDinner" and "LastDinner" or nil, MainModule.ToggleRefs.ZoneKill) MainModule.update_toggle_availability("VoidKill", gameName == "SkySquidGame" and "SkySquidGame" or nil, MainModule.ToggleRefs.VoidKill) MainModule.update_toggle_availability("SkySquidAntiFall", gameName == "SkySquidGame" and "SkySquidGame" or nil, MainModule.ToggleRefs.SkySquidAntiFall) MainModule.update_toggle_availability("MingleVoidKill", gameName == "Mingle" and "Mingle" or nil, MainModule.ToggleRefs.MingleVoidKill) MainModule.update_toggle_availability("GodMode", gameName == "RedLightGreenLight" and "RedLightGreenLight" or nil, MainModule.ToggleRefs.GodMode) MainModule.update_toggle_availability("RemoveInjury", gameName == "RedLightGreenLight" and "RedLightGreenLight" or nil, MainModule.ToggleRefs.RemoveInjury) MainModule.update_toggle_availability("AutoChoke", gameName == "Mingle" and "Mingle" or nil, MainModule.ToggleRefs.AutoChoke) MainModule.update_toggle_availability("AutoPickupKeys", gameName == "HideAndSeek" and "HideAndSeek" or nil, MainModule.ToggleRefs.AutoPickup) end MainModule.GameStateMonitor = { Connection = nil, LastGame = nil } MainModule.GameStateMonitor.Start = function() if MainModule.GameStateMonitor.Connection then MainModule.GameStateMonitor.Connection:Disconnect() end MainModule.GameStateMonitor.Connection = RunService.Heartbeat:Connect(function() local values = Workspace:FindFirstChild("Values") if not values then return end local currentGame = values:FindFirstChild("CurrentGame") local gameName = currentGame and currentGame.Value if gameName ~= MainModule.GameStateMonitor.LastGame then if MainModule.GameStateMonitor.LastGame then MainModule.GameStateMonitor.DisableGameToggles(MainModule.GameStateMonitor.LastGame) end MainModule.GameStateMonitor.LastGame = gameName MainModule.update_all_toggles_by_game() end end) end MainModule.GameStateMonitor.DisableGameToggles = function(gameName) local toggles = { HideAndSeek = {"AutoDodge", "InfiniteStamina", "SpikesKill", "AutoEscape", "KeyESP", "AutoPickupKeys"}, JumpRope = {"JumpRopeAntiFall"}, GlassBridge = {"GlassESP", "AntiBreak"}, LastDinner = {"ZoneKill"}, SkySquidGame = {"VoidKill", "SkySquidAntiFall"}, Mingle = {"MingleVoidKill", "AutoChoke"}, RedLightGreenLight = {"GodMode", "RemoveInjury"} } local gameToggles = toggles[gameName] if gameToggles then for _, toggleName in ipairs(gameToggles) do MainModule.disable_toggle(toggleName) end end end MainModule.GameStateMonitor.Start() MainModule.teleport_to_safe_spot = function() if MainModule.is_game_active("LastDinner") then MainModule.safe_teleport(Vector3.new(0, 100, 0)) MainModule.notify("Last Dinner", "Teleported to Safe Spot", 0.9) else MainModule.notify("Last Dinner", "Wait for LastDinner!", 0.9) PlayErrorSound() end PlayBell() end MainModule.RebelEnabled = false MainModule.RebelShotsPerTick = 10 MainModule.RebelConnection = nil MainModule.RebelGun = nil MainModule.RebelEnemiesCache = {} MainModule.RebelEnemiesUpdateTime = 0 MainModule.RebelEnemiesIndex = 1 MainModule.RebelEnemiesList = {} local function FindRebelGun() local char = MainModule.get_character() local backpack = LocalPlayer:FindFirstChild("Backpack") local gun = nil if char then for _, tool in ipairs(char:GetChildren()) do if tool:IsA("Tool") and (tool:GetAttribute("Gun") or tool:FindFirstChild("GunScript") or string.lower(tool.Name):find("gun")) then gun = tool break end end end if not gun and backpack then for _, tool in ipairs(backpack:GetChildren()) do if tool:IsA("Tool") and (tool:GetAttribute("Gun") or tool:FindFirstChild("GunScript") or string.lower(tool.Name):find("gun")) then gun = tool break end end end return gun end local function UpdateRebelEnemies() if tick() - MainModule.RebelEnemiesUpdateTime < 0.1 then return end MainModule.RebelEnemiesUpdateTime = tick() local hits = {} local live = workspace:FindFirstChild("Live") if live then for _, enemy in ipairs(live:GetChildren()) do if enemy:IsA("Model") and enemy:FindFirstChild("Enemy") and not enemy:FindFirstChild("Dead") then local isPlayer = false for _, player in ipairs(Players:GetPlayers()) do if player.Name == enemy.Name then isPlayer = true break end end if not isPlayer then hits[enemy.Name] = "Head" end end end end MainModule.RebelEnemiesCache = hits MainModule.RebelEnemiesIndex = 1 MainModule.RebelEnemiesList = {} for name, part in pairs(hits) do MainModule.RebelEnemiesList[#MainModule.RebelEnemiesList + 1] = {name = name, part = part} end end local function GetNextTargets(max) if not MainModule.RebelEnemiesList or #MainModule.RebelEnemiesList == 0 then return {} end local targets = {} local count = 0 local list = MainModule.RebelEnemiesList for i = MainModule.RebelEnemiesIndex, #list do local item = list[i] targets[item.name] = item.part count = count + 1 MainModule.RebelEnemiesIndex = i + 1 if count >= max then break end end if MainModule.RebelEnemiesIndex > #list then MainModule.RebelEnemiesIndex = 1 end return targets end local function StartRebelLoop() if MainModule.RebelConnection then MainModule.RebelConnection:Disconnect() MainModule.RebelConnection = nil end MainModule.RebelConnection = RunService.Heartbeat:Connect(function() if not MainModule.RebelEnabled then return end if not MainModule.RebelGun or tick() % 1 < 0.02 then MainModule.RebelGun = FindRebelGun() end if not MainModule.RebelGun then return end UpdateRebelEnemies() if not MainModule.RebelEnemiesList or #MainModule.RebelEnemiesList == 0 then return end local remotes = ReplicatedStorage:FindFirstChild("Remotes") if not remotes then return end local remote = remotes:FindFirstChild("FiredGunClient") if not remote then return end local rayInst = workspace:FindFirstChild("StairWalkWay") and workspace.StairWalkWay:FindFirstChild("Part") or workspace local targets = GetNextTargets(5) local args = { MainModule.RebelGun, { ClientRayNormal = Vector3.new(0, 1, 0), FiredGun = true, SecondaryHitTargets = {}, ClientRayInstance = rayInst, ClientRayPosition = Vector3.new(0, 0, 0), bulletCF = CFrame.new(), HitTargets = targets, bulletSizeC = Vector3.new(0.01, 0.01, 5), NoMuzzleFX = true, FirePosition = Vector3.new(0, 0, 0) } } for _ = 1, math.min(MainModule.RebelShotsPerTick, 3) do pcall(function() remote:FireServer(unpack(args)) end) end end) end function MainModule.toggle_rebel_v2(enabled) MainModule.RebelEnabled = enabled if MainModule.RebelConnection then MainModule.RebelConnection:Disconnect() MainModule.RebelConnection = nil end MainModule.RebelGun = nil MainModule.RebelEnemiesList = {} MainModule.RebelEnemiesIndex = 1 if enabled then StartRebelLoop() else end PlayToggleSound() end function MainModule.set_rebel_shots_per_tick(value) MainModule.RebelShotsPerTick = value end MainModule.NoRecoilEnabled = false MainModule.NoRecoilConnection = nil MainModule.NoRecoilExtraConns = {} local function disconnectNoRecoilConns() if MainModule.NoRecoilConnection then pcall(function() MainModule.NoRecoilConnection:Disconnect() end) MainModule.NoRecoilConnection = nil end if MainModule.NoRecoilExtraConns then for _, conn in ipairs(MainModule.NoRecoilExtraConns) do pcall(function() conn:Disconnect() end) end end MainModule.NoRecoilExtraConns = {} end local function zeroObj(obj) if not obj then return end pcall(function() if obj:IsA("NumberValue") or obj:IsA("IntValue") then obj.Value = 0 elseif obj:IsA("Vector3Value") then obj.Value = Vector3.zero elseif obj:IsA("BoolValue") then obj.Value = false elseif obj:IsA("Folder") or obj:IsA("Configuration") then for _, ch in ipairs(obj:GetDescendants()) do if ch:IsA("NumberValue") or ch:IsA("IntValue") then ch.Value = 0 elseif ch:IsA("Vector3Value") then ch.Value = Vector3.zero end end end end) end local function stripGun(gun) if not gun then return end pcall(function() for _, name in ipairs({"Spread", "Recoil", "RecoilShake"}) do local o = gun:FindFirstChild(name) if o then if o:IsA("NumberValue") or o:IsA("IntValue") or o:IsA("Vector3Value") or o:IsA("BoolValue") then zeroObj(o) elseif o:IsA("Folder") or o:IsA("Configuration") then zeroObj(o) else if name ~= "Spread" then pcall(function() o:Destroy() end) else zeroObj(o) end end end end for _, d in ipairs(gun:GetDescendants()) do if d.Name == "Spread" or d.Name == "Recoil" or d.Name == "RecoilShake" then if d:IsA("NumberValue") or d:IsA("IntValue") or d:IsA("Vector3Value") then zeroObj(d) elseif d.Name ~= "Spread" and (d:IsA("Folder") or d:IsA("Configuration")) then zeroObj(d) end end end if gun.SetAttribute then gun:SetAttribute("Spread", 0) gun:SetAttribute("Recoil", 0) gun:SetAttribute("RecoilShake", 0) end end) end local function getGunsFolder() local weapons = ReplicatedStorage:FindFirstChild("Weapons") return weapons and weapons:FindFirstChild("Guns") or nil end local function applyAllGuns() local guns = getGunsFolder() if guns then for _, gun in ipairs(guns:GetChildren()) do stripGun(gun) end end local char = LocalPlayer.Character if char then for _, t in ipairs(char:GetChildren()) do if t:IsA("Tool") then stripGun(t) end end end local bag = LocalPlayer:FindFirstChild("Backpack") if bag then for _, t in ipairs(bag:GetChildren()) do if t:IsA("Tool") then stripGun(t) end end end end local function bindValueStayZero(o) if not o or not (o:IsA("NumberValue") or o:IsA("IntValue")) then return end table.insert(MainModule.NoRecoilExtraConns, o:GetPropertyChangedSignal("Value"):Connect(function() if MainModule.NoRecoilEnabled and o.Parent and o.Value ~= 0 then o.Value = 0 end end)) end function MainModule.toggle_no_recoil(enabled) enabled = enabled and true or false MainModule.NoRecoilEnabled = enabled disconnectNoRecoilConns() if not enabled then if PlayToggleSound then PlayToggleSound() end return true end local function stripCamera() local cam = workspace.CurrentCamera if not cam then return end for _, name in ipairs({"CameraRecoil", "Recoil", "Spread", "CameraShake", "RecoilShake"}) do local o = cam:FindFirstChild(name) if o then pcall(function() o:Destroy() end) end end end local function stripGunValues(gun) if not gun then return end pcall(function() for _, name in ipairs({"Spread", "Recoil", "RecoilShake"}) do local o = gun:FindFirstChild(name, true) if o then if o:IsA("NumberValue") or o:IsA("IntValue") then o.Value = 0 elseif o:IsA("Vector3Value") then o.Value = Vector3.zero elseif o:IsA("BoolValue") then o.Value = false end end end if gun.SetAttribute then gun:SetAttribute("Spread", 0) gun:SetAttribute("Recoil", 0) end end) end local function applyAll() pcall(function() local w = ReplicatedStorage:FindFirstChild("Weapons") if w and w:FindFirstChild("Guns") then for _, gun in ipairs(w.Guns:GetChildren()) do stripGunValues(gun) end end local c = MainModule.get_character and MainModule.get_character() if c then for _, t in ipairs(c:GetChildren()) do if t:IsA("Tool") then stripGunValues(t) end end end local bp = LocalPlayer:FindFirstChild("Backpack") if bp then for _, t in ipairs(bp:GetChildren()) do if t:IsA("Tool") then stripGunValues(t) end end end end) end applyAll() MainModule.NoRecoilConnection = RunService.RenderStepped:Connect(function() if not MainModule.NoRecoilEnabled then return end stripCamera() applyAll() end) if PlayToggleSound then PlayToggleSound() end return true end function MainModule.toggle_spikes_esp(enabled) MainModule.SpikesESPEnabled = enabled and true or false for _, h in pairs(MainModule.SpikesESPObjects) do pcall(function() if type(h) == "table" then for _, o in pairs(h) do if o and o.Destroy then o:Destroy() end end elseif h and h.Destroy then h:Destroy() end end) end MainModule.SpikesESPObjects = {} if MainModule.SpikesESPConn then pcall(function() MainModule.SpikesESPConn:Disconnect() end) MainModule.SpikesESPConn = nil end if MainModule.SpikesESPFolder then pcall(function() MainModule.SpikesESPFolder:Destroy() end) MainModule.SpikesESPFolder = nil end if not enabled then PlayToggleSound() return true end local folder = Instance.new("Folder") folder.Name = "HSX_SpikesESP" folder.Parent = workspace MainModule.SpikesESPFolder = folder local function find_killing_parts() local results = {} local function consider(kp) if kp and not results[kp] then results[kp] = true end end local map = workspace:FindFirstChild("HideAndSeekMap") or Workspace:FindFirstChild("HideAndSeekMap") if map then consider(map:FindFirstChild("KillingParts")) for _, d in ipairs(map:GetDescendants()) do if d.Name == "KillingParts" then consider(d) end end end for _, d in ipairs(workspace:GetDescendants()) do if d.Name == "KillingParts" then consider(d) end end local list = {} for kp in pairs(results) do table.insert(list, kp) end return list end local function add_esp(part) if not part or not part:IsA("BasePart") then return end if MainModule.SpikesESPObjects[part] then return end local h = Instance.new("Highlight") h.Name = "HSX_SpikeHL" h.Adornee = part h.DepthMode = Enum.HighlightDepthMode.AlwaysOnTop h.FillColor = Color3.fromRGB(0, 0, 0) h.OutlineColor = Color3.fromRGB(0, 0, 0) h.FillTransparency = 0.35 h.OutlineTransparency = 0 h.Parent = folder MainModule.SpikesESPObjects[part] = h pcall(function() local box = Instance.new("BoxHandleAdornment") box.Name = "HSX_SpikeBox" box.Adornee = part box.AlwaysOnTop = true box.ZIndex = 10 box.Size = part.Size box.Color3 = Color3.fromRGB(0, 0, 0) box.Transparency = 0.4 box.Parent = folder MainModule.SpikesESPObjects[part] = { h, box } end) end local function refresh() if not MainModule.SpikesESPEnabled then return end for _, kp in ipairs(find_killing_parts()) do for _, part in ipairs(kp:GetDescendants()) do if part:IsA("BasePart") then add_esp(part) end end for _, part in ipairs(kp:GetChildren()) do if part:IsA("BasePart") then add_esp(part) elseif part:IsA("Model") then for _, d in ipairs(part:GetDescendants()) do if d:IsA("BasePart") then add_esp(d) end end end end end end refresh() MainModule.SpikesESPConn = RunService.Heartbeat:Connect(function() if not MainModule.SpikesESPEnabled then return end if not MainModule._spikes_esp_t then MainModule._spikes_esp_t = 0 end if tick() - MainModule._spikes_esp_t < 0.75 then return end MainModule._spikes_esp_t = tick() refresh() end) PlayToggleSound() return true end local selectedPlayer = nil local function formatNumberWithCommas(num) if num == "-" or num == nil then return "-" end if type(num) ~= "number" then num = tonumber(num) or 0 end local formatted = tostring(math.floor(num)) local k = formatted:reverse():gsub("(%d%d%d)", "%1,"):reverse() if k:sub(1,1) == "," then k = k:sub(2) end return k end local function getBoostFromAllSources(player, boostName) local checkFolder = function(folder) if folder then for _, child in pairs(folder:GetChildren()) do if child.Name == boostName and (child:IsA("NumberValue") or child:IsA("IntValue")) then return child.Value end if string.lower(child.Name):find(string.lower(boostName)) and (child:IsA("NumberValue") or child:IsA("IntValue")) then return child.Value end end end return nil end local boosts = player:FindFirstChild("Boosts") if boosts then local val = checkFolder(boosts) if val then return val end end local boostData = player:FindFirstChild("_BoostData") if boostData then local val = checkFolder(boostData) if val then return val end end local liveFolder = workspace:FindFirstChild("Live") if liveFolder then local playerFolder = liveFolder:FindFirstChild(player.Name) if playerFolder then local boostsLive = playerFolder:FindFirstChild("Boosts") if boostsLive then local val = checkFolder(boostsLive) if val then return val end end local boostDataLive = playerFolder:FindFirstChild("_BoostData") if boostDataLive then local val = checkFolder(boostDataLive) if val then return val end end end end local attrs = player:GetAttributes() for name, val in pairs(attrs) do if string.lower(name):find(string.lower(boostName)) and type(val) == "number" then return val end end return 0 end MainModule._PlayerStatLabels = MainModule._PlayerStatLabels or {} local function updateStatsDisplay(player) local L = MainModule._PlayerStatLabels if not L or not next(L) then return end local function set(name, text) local el = L[name] if not el then return end pcall(function() if el.SetTitle then el:SetTitle(text) elseif el.SetDesc then el:SetDesc(text) elseif el.SetText then el:SetText(text) end end) end if not player or not player.Parent then for k in pairs(L) do set(k, k:gsub("^%l", string.upper) .. ": -") end return end local attrs = player:GetAttributes() local function fmt(n) n = tonumber(n) or 0 local s = tostring(math.floor(n)) local k = s:reverse():gsub("(%d%d%d)", "%1,"):reverse() if k:sub(1,1) == "," then k = k:sub(2) end return k end set("Wins", "Wins: " .. fmt(attrs._GameWins or 0)) set("Money", "Money: " .. fmt(attrs._Won or 0)) set("Power", "Equipped Power: " .. tostring(attrs._EquippedPower or "-")) set("GuardPower", "Guard Power: " .. tostring(attrs._EquippedGuardPower or "-")) set("Level", "Level: " .. tostring(attrs._CurrentLevel or attrs._Level or attrs.Level or 0)) set("PowerSpins", "Power Spins: " .. fmt(attrs._TotalPowerSpins or 0)) set("GuardSpins", "Guard Spins: " .. fmt(attrs._TotalGuardPowerSpins or 0)) set("Robux", "Robux Donated: " .. fmt(attrs._TotalRobuxDonated or attrs._RobuxDonated or 0)) set("VIP", "VIP: " .. ((attrs.__OwnsVIPGamepass and "Yes") or "No")) set("PermGuard", "Perm Guard: " .. ((attrs.__OwnsPermGuard and "Yes") or "No")) set("Lighter", "Lighter: " .. ((attrs.HasLighter and "Yes") or "No")) end local function refreshPlayerList() local players = {} for _, plr in pairs(Players:GetPlayers()) do if plr ~= LocalPlayer then table.insert(players, plr.Name) end end if #players == 0 then table.insert(players, "No players") end return players end Players.PlayerAdded:Connect(function() end) Players.PlayerRemoving:Connect(function() if selectedPlayer and not selectedPlayer.Parent then selectedPlayer = nil updateStatsDisplay(nil) end end) RunService.Heartbeat:Connect(function() if selectedPlayer and selectedPlayer.Parent then updateStatsDisplay(selectedPlayer) end end) local playerListForTeleport = {} local function updatePlayerListForTeleport() playerListForTeleport = {} for _, plr in pairs(Players:GetPlayers()) do if plr ~= LocalPlayer then table.insert(playerListForTeleport, plr.Name) end end if #playerListForTeleport == 0 then table.insert(playerListForTeleport, "No players") end end updatePlayerListForTeleport() local selectedTeleportPlayer = nil Players.PlayerAdded:Connect(function() task.wait(0.1) updatePlayerListForTeleport() end) Players.PlayerRemoving:Connect(function() task.wait(0.1) if selectedTeleportPlayer and not Players:FindFirstChild(selectedTeleportPlayer.Name) then selectedTeleportPlayer = nil end updatePlayerListForTeleport() end) MainModule.PeabertEnabled = false MainModule.PeabertShotsPerTick = 15 MainModule.PeabertConnection = nil function MainModule.start_peabert_loop() if MainModule.PeabertConnection then MainModule.PeabertConnection:Disconnect() MainModule.PeabertConnection = nil end MainModule.PeabertConnection = RunService.RenderStepped:Connect(function() if not MainModule.PeabertEnabled then return end local char = MainModule.get_character() local backpack = LocalPlayer:FindFirstChild("Backpack") local gun = nil if char then for _, tool in ipairs(char:GetChildren()) do if tool:IsA("Tool") and (tool:GetAttribute("Gun") or tool:FindFirstChild("GunScript") or string.lower(tool.Name):find("gun")) then gun = tool break end end end if not gun and backpack then for _, tool in ipairs(backpack:GetChildren()) do if tool:IsA("Tool") and (tool:GetAttribute("Gun") or tool:FindFirstChild("GunScript") or string.lower(tool.Name):find("gun")) then gun = tool break end end end if not gun then return end local hitTargetsTable = {} local live = workspace:FindFirstChild("Live") if live then for i = 1, 10 do local name = "EvilPeabert1_" .. i local enemy = live:FindFirstChild(name) if enemy and not enemy:FindFirstChild("Dead") then hitTargetsTable[name] = "Head" end end for _, enemy in ipairs(live:GetChildren()) do if not enemy:FindFirstChild("Dead") then local name = enemy.Name if name:match("^PeabertSpawn%d+$") then local num = tonumber(name:match("%d+")) if num and num >= 1 and num <= 31 then hitTargetsTable[name] = "Head" end end if name:lower():find("peabert") or name:lower():find("evilpeabert") then hitTargetsTable[name] = "Head" end end end end for _, obj in ipairs(workspace:GetDescendants()) do if (obj:IsA("Model") or obj:IsA("BasePart")) and not obj:FindFirstChild("Dead") then local name = obj.Name if name:match("^EvilPeabert1_%d+$") or name:match("^PeabertSpawn%d+$") or name:lower():find("peabert") then hitTargetsTable[name] = "Head" end end end if next(hitTargetsTable) ~= nil then local remotes = ReplicatedStorage:FindFirstChild("Remotes") if remotes then local remote = remotes:FindFirstChild("FiredGunClient") if remote then local rayInst = workspace:FindFirstChild("StairWalkWay") and workspace.StairWalkWay:FindFirstChild("Part") or workspace local args = { gun, { ClientRayNormal = Vector3.new(0, 1, 0), FiredGun = true, SecondaryHitTargets = {}, ClientRayInstance = rayInst, ClientRayPosition = Vector3.new(0, 0, 0), bulletCF = CFrame.new(), HitTargets = hitTargetsTable, bulletSizeC = Vector3.new(0.01, 0.01, 5), NoMuzzleFX = true, FirePosition = Vector3.new(0, 0, 0) } } for _ = 1, MainModule.PeabertShotsPerTick do pcall(function() remote:FireServer(unpack(args)) end) end end end end end) end function MainModule.toggle_peabert_kill(enabled) MainModule.PeabertEnabled = enabled if MainModule.PeabertConnection then MainModule.PeabertConnection:Disconnect() MainModule.PeabertConnection = nil end if enabled then MainModule.start_peabert_loop() else end PlayToggleSound() end function MainModule.set_peabert_shots_per_tick(value) MainModule.PeabertShotsPerTick = value end loadstring([[ function LPH_NO_VIRTUALIZE(f) return f end; ]])(); loadstring([[ function LPH_NO_VIRTUALIZE(f) return f end; ]])(); --@encrypt_start loadstring([[ function LPH_NO_VIRTUALIZE(f) return f end; ]])(); MainModule.FakeLightningAwakeningEnabled = false MainModule._LA_Inited = false MainModule.toggle_fake_lightning_awakening = function(enabled) MainModule.FakeLightningAwakeningEnabled = enabled and true or false if not enabled then pcall(function() local bp = LocalPlayer:FindFirstChild("Backpack") if bp then local x = bp:FindFirstChild("LIGHTNING AWAKENING") if x then x:Destroy() end end local c = LocalPlayer.Character if c then local x = c:FindFirstChild("LIGHTNING AWAKENING") if x then x:Destroy() end end end) PlayToggleSound() return true end if not MainModule._LA_Inited then MainModule._LA_Inited = true MainModule._LA_Start() end PlayToggleSound() return true end MainModule._LA_Start = function() --@encrypt_start local Players = game:GetService("Players") local RunService = game:GetService("RunService") local TweenService = game:GetService("TweenService") local ReplicatedStorage = game:GetService("ReplicatedStorage") local Debris = game:GetService("Debris") local LocalPlayer = Players.LocalPlayer local Camera = workspace.CurrentCamera local RS = ReplicatedStorage local EffectFolder = RS:FindFirstChild("Effects") and RS.Effects:FindFirstChild("SetupParts") and RS.Effects.SetupParts:FindFirstChild("CustomEffectsFolders") and RS.Effects.SetupParts.CustomEffectsFolders:FindFirstChild("LIGHTNINGGODAWAKENING") local Animations = RS:FindFirstChild("Animations") local AwakeningAnim = Animations and Animations:FindFirstChild("Abilities") and Animations.Abilities:FindFirstChild("LightningGodAwakening") local CamModule = RS:FindFirstChild("CustomCameraModules") and RS.CustomCameraModules:FindFirstChild("LightningAwakening") local ModulesFolder = RS:FindFirstChild("Modules") local EffectsModule, EffectsSecond pcall(function() EffectsModule = ModulesFolder and ModulesFolder:FindFirstChild("Effects") and require(ModulesFolder.Effects) end) pcall(function() EffectsSecond = ModulesFolder and ModulesFolder:FindFirstChild("EffectsSecond") and require(ModulesFolder.EffectsSecond) end) local CamData = nil if CamModule then pcall(function() local r = require(CamModule) if typeof(r) == "function" then CamData = r() else CamData = r end end) end local FOV_DATA = CamData and CamData.FOV local CAMERA_FRAMES = CamData and CamData.Frames if not FOV_DATA then FOV_DATA = {} for i = 1, 250 do FOV_DATA[i] = 70 end end if not CAMERA_FRAMES then CAMERA_FRAMES = {} for i = 1, 250 do CAMERA_FRAMES[i] = {0,2,-8,-1,0,0,0,1,0,0,0,-1} end end local isPlaying, cooldown, hasActivated = false, false, false local function frameToCFrame(f) return CFrame.new(f[1],f[2],f[3],f[4],f[5],f[6],f[7],f[8],f[9],f[10],f[11],f[12]) end local function setupWeldedPart(template, parent, hrp, c0) if not template or not parent or not hrp then return nil end local clone = template:Clone() if clone:IsA("BasePart") then clone.Anchored = false clone.CanCollide = false clone.Massless = true local weld = Instance.new("Weld") weld.Part0 = hrp weld.Part1 = clone weld.C0 = c0 or CFrame.new() weld.Parent = clone clone.Parent = parent elseif clone:IsA("Model") then clone.Parent = parent for _, desc in clone:GetDescendants() do if desc and desc:IsA("BasePart") then desc.Anchored = false desc.CanCollide = false desc.Massless = true local weld = Instance.new("Weld") weld.Part0 = hrp weld.Part1 = desc weld.C0 = c0 or CFrame.new() weld.Parent = desc end end end for _, desc in clone:GetDescendants() do if desc then if desc:IsA("ParticleEmitter") then desc.Enabled = true end if desc:IsA("PointLight") then desc.Enabled = true end end end return clone end local function createFakeCharacter(character) local hrp = character:FindFirstChild("HumanoidRootPart") if not hrp then return nil end local savedArchivable = {} for _, obj in character:GetDescendants() do savedArchivable[obj] = obj.Archivable obj.Archivable = true end local origArch = character.Archivable character.Archivable = true local ok, fakeModel = pcall(function() return character:Clone() end) character.Archivable = origArch for obj, val in savedArchivable do if obj and obj.Parent then pcall(function() obj.Archivable = val end) end end if not ok or not fakeModel then return nil end fakeModel.Name = "FakeChar_LightningAwakening" local toDestroy = {} for _, obj in fakeModel:GetDescendants() do if obj:IsA("Script") or obj:IsA("LocalScript") or obj:IsA("Tool") or obj:IsA("ModuleScript") then table.insert(toDestroy, obj) end end for _, obj in toDestroy do pcall(function() if obj and obj.Parent then obj:Destroy() end end) end for _, desc in fakeModel:GetDescendants() do if desc and desc:IsA("BasePart") then pcall(function() desc.CanCollide = false desc.CanQuery = false desc.CanTouch = false desc.Massless = true desc.Anchored = false end) end end local fakeHRP = fakeModel:FindFirstChild("HumanoidRootPart") if fakeHRP then fakeHRP.Anchored = true end local fakeHum = fakeModel:FindFirstChildOfClass("Humanoid") if fakeHum then pcall(function() fakeHum.DisplayDistanceType = Enum.HumanoidDisplayType.None fakeHum.HealthDisplayType = Enum.HumanoidHealthDisplayType.AlwaysOff fakeHum.BreakJointsOnDeath = false fakeHum.RequiresNeck = false end) end fakeModel.Parent = workspace return fakeModel end local function restoreCharacter(character, humanoid, hrp, savedPosition, wasAnchored, origWS, origJP, origFOV, origCamType) if character and character.Parent then for _, part in character:GetDescendants() do if part and part:IsA("BasePart") then pcall(function() part.LocalTransparencyModifier = 0 end) end end end if hrp and hrp.Parent then pcall(function() hrp.Anchored = false hrp.CFrame = savedPosition hrp.Anchored = wasAnchored hrp.AssemblyLinearVelocity = Vector3.zero hrp.AssemblyAngularVelocity = Vector3.zero end) end pcall(function() Camera.CameraType = origCamType or Enum.CameraType.Custom TweenService:Create(Camera, TweenInfo.new(0.5, Enum.EasingStyle.Quad), {FieldOfView = origFOV or 70}):Play() end) if humanoid and humanoid.Parent then pcall(function() humanoid.WalkSpeed = (origWS and origWS > 0) and origWS or 16 humanoid.JumpPower = (origJP and origJP > 0) and origJP or 50 humanoid.JumpHeight = 7.2 humanoid.AutoRotate = true humanoid.PlatformStand = false humanoid.Sit = false humanoid:ChangeState(Enum.HumanoidStateType.GettingUp) end) end end local function activate() if isPlaying or cooldown or not MainModule.FakeLightningAwakeningEnabled then return end local character = LocalPlayer.Character if not character then return end local humanoid = character:FindFirstChild("Humanoid") local hrp = character:FindFirstChild("HumanoidRootPart") local head = character:FindFirstChild("Head") if not humanoid or not hrp then return end isPlaying, cooldown = true, true local origFOV, origCamType = Camera.FieldOfView, Camera.CameraType local origWS, origJP = humanoid.WalkSpeed, humanoid.JumpPower local savedPosition, wasAnchored = hrp.CFrame, hrp.Anchored local teleportHeight = 150 local hasRestored = false local function safeRestore() if hasRestored then return end hasRestored = true pcall(function() restoreCharacter(character, humanoid, hrp, savedPosition, wasAnchored, origWS, origJP, origFOV, origCamType) end) isPlaying = false task.delay(3, function() cooldown = false end) end local ok = pcall(function() humanoid.WalkSpeed = 0 humanoid.JumpPower = 0 humanoid.AutoRotate = false local fakeChar = createFakeCharacter(character) if not fakeChar then error("Failed to create fake character") end local fakeHRP = fakeChar:FindFirstChild("HumanoidRootPart") local fakeHum = fakeChar:FindFirstChildOfClass("Humanoid") local fakeHead = fakeChar:FindFirstChild("Head") if fakeHRP then fakeHRP.CFrame = savedPosition end local fakeBodyParts = {} for _, n in {"Head","Torso","Left Arm","Right Arm","Left Leg","Right Leg","UpperTorso","LowerTorso","LeftUpperArm","RightUpperArm","LeftLowerArm","RightLowerArm","LeftUpperLeg","RightUpperLeg","LeftLowerLeg","RightLowerLeg","LeftHand","RightHand","LeftFoot","RightFoot"} do local p = fakeChar:FindFirstChild(n) if p and p:IsA("BasePart") then table.insert(fakeBodyParts, p) end end local function getLiveParts() local out = {} for _, p in fakeBodyParts do if p and typeof(p) == "Instance" and p.Parent then table.insert(out, p) end end return out end hrp.Anchored = true task.wait() hrp.CFrame = savedPosition * CFrame.new(0, teleportHeight, 0) hrp.Anchored = true for _, part in character:GetDescendants() do if part and part:IsA("BasePart") then pcall(function() part.LocalTransparencyModifier = 1 end) end end local fakeUpdateConn = RunService.Heartbeat:Connect(function() if fakeChar and fakeChar.Parent and fakeHRP and fakeHRP.Parent then fakeHRP.CFrame = savedPosition end end) local moveConn = RunService.Heartbeat:Connect(function() if isPlaying and hrp and hrp.Parent then hrp.CFrame = savedPosition * CFrame.new(0, teleportHeight, 0) hrp.AssemblyLinearVelocity = Vector3.zero hrp.AssemblyAngularVelocity = Vector3.zero end end) local animTrack = nil if AwakeningAnim and fakeHum then pcall(function() local anim = Instance.new("Animation") anim.AnimationId = AwakeningAnim.AnimationId local animator = fakeHum:FindFirstChildOfClass("Animator") if not animator then animator = Instance.new("Animator"); animator.Parent = fakeHum end animTrack = animator:LoadAnimation(anim) animTrack.Priority = Enum.AnimationPriority.Action4 animTrack:Play() end) end local animSound if fakeHRP then animSound = Instance.new("Sound") animSound.SoundId = "rbxassetid://103481331692768" animSound.Volume = 2 animSound.RollOffMaxDistance = 300 animSound.Parent = fakeHRP animSound:Play() end local frameInterval = 1 / 60 local totalFrames = math.min(#CAMERA_FRAMES, #FOV_DATA) local totalDuration = totalFrames * frameInterval Camera.CameraType = Enum.CameraType.Scriptable local startTime = tick() local camConn camConn = RunService.RenderStepped:Connect(function() local elapsed = tick() - startTime local rawFrame = elapsed / frameInterval local fi = math.floor(rawFrame) + 1 if fi > totalFrames then pcall(function() camConn:Disconnect() end) return end local alpha = rawFrame - math.floor(rawFrame) local ni = math.min(fi + 1, totalFrames) Camera.FieldOfView = FOV_DATA[fi] + (FOV_DATA[ni] - FOV_DATA[fi]) * alpha local cf1 = frameToCFrame(CAMERA_FRAMES[fi]) local cf2 = frameToCFrame(CAMERA_FRAMES[ni]) Camera.CFrame = savedPosition * cf1:Lerp(cf2, alpha) end) if EffectsModule and EffectsModule.PrepFrame then local prepImages = {} local impFramesFolder = RS:FindFirstChild("ImpactFrames") if impFramesFolder then local lgFolder = impFramesFolder:FindFirstChild("LightningGod") if lgFolder then for _, v in lgFolder:GetDescendants() do if v and v.ClassName == "ImageLabel" then table.insert(prepImages, v.Image) end end end end if #prepImages > 0 then task.spawn(function() pcall(function() EffectsModule.PrepFrame({ EffectName = "PrepFrame", ImageTable = prepImages }) end) end) end end pcall(function() if EffectFolder and EffectFolder:FindFirstChild("start") then for _, emitter in EffectFolder.start:GetChildren() do if emitter and emitter:IsA("ParticleEmitter") then local emitterName = emitter.Name for _, limb in getLiveParts() do if limb.Name ~= "Head" or emitterName ~= "Lightning1" then local clone = emitter:Clone() clone.Enabled = true clone.Parent = limb task.delay(1.52, function() if clone and clone.Parent then clone.Enabled = false end end) Debris:AddItem(clone, 1.6) end end end end end end) task.delay(1.55, function() if not isPlaying then return end pcall(function() if EffectFolder and EffectFolder:FindFirstChild("Aura1") and fakeHRP and fakeHRP.Parent then local auraClone = setupWeldedPart(EffectFolder.Aura1, fakeChar, fakeHRP, CFrame.new(-0.386, -0.425, -0.538)) if auraClone then task.delay(1.33, function() if auraClone and auraClone.Parent then for _, desc in auraClone:GetDescendants() do if desc and desc:IsA("ParticleEmitter") then desc.Enabled = false end end end end) Debris:AddItem(auraClone, 2.3) end end if EffectFolder and EffectFolder:FindFirstChild("eyes") and fakeHead and fakeHead.Parent then for _, child in EffectFolder.eyes:GetChildren() do if child and child:IsA("Attachment") then local clone = child:Clone() clone.Parent = fakeHead for _, desc in clone:GetDescendants() do if desc and desc:IsA("ParticleEmitter") then desc.Enabled = true end end Debris:AddItem(clone, 2.61) end end end end) end) task.delay(2.85, function() if not isPlaying then return end pcall(function() if EffectFolder and EffectFolder:FindFirstChild("Strike") and fakeHRP and fakeHRP.Parent then local sf = EffectFolder.Strike local am = sf:FindFirstChild("Model") if am then local ac = setupWeldedPart(am, fakeChar, fakeHRP, CFrame.new(0.221, 14.591, -2.723)) if ac then Debris:AddItem(ac, 2.5) end end local gp = sf:FindFirstChild("LightningImpactGround") if gp then local gc = setupWeldedPart(gp, fakeChar, fakeHRP, CFrame.new(0.222, -0.35, -2.723)) if gc then Debris:AddItem(gc, 2.5) local bl = gc:FindFirstChild("BlastLight", true) if not bl then local imp = gc:FindFirstChild("Impact", true) if imp then bl = imp:FindFirstChild("BlastLight") end end if bl and bl:IsA("PointLight") then bl.Enabled = true task.delay(0.42, function() if bl and bl.Parent then TweenService:Create(bl, TweenInfo.new(0.35, Enum.EasingStyle.Linear), {Brightness=2}):Play() end end) end end end end if EffectFolder and EffectFolder:FindFirstChild("Lines1") then local lines = EffectFolder.Lines1 if lines:IsA("ParticleEmitter") then for _, limb in getLiveParts() do local clone = lines:Clone() clone.Enabled = true clone.Parent = limb Debris:AddItem(clone, 0.8) end end end if EffectFolder and EffectFolder:FindFirstChild("AuraLightning") then for _, emitter in EffectFolder.AuraLightning:GetChildren() do if emitter and emitter:IsA("ParticleEmitter") then for _, limb in getLiveParts() do local clone = emitter:Clone() clone.Enabled = true clone.Parent = limb Debris:AddItem(clone, 0.8) end end end end local myChar = LocalPlayer.Character if myChar and myChar:FindFirstChild("Remotes") then local relay = myChar.Remotes:FindFirstChild("Relay") if relay then relay:Fire({EffectName="MauioShake",Length=0.45,TweenSpeed=0.075,AxisMultipliers=Vector3.new(1,0.15,1),FadeStyle="inQuad",PositionStyle="inCubic",Intensity=2}) end end end) end) task.delay(2.9, function() if not isPlaying then return end if EffectsSecond and EffectsSecond.ImpactFrames then pcall(function() EffectsSecond.ImpactFrames({foldername = "LightningGod", displaytime = 0.015}) end) end end) task.delay(3.65, function() if not isPlaying then return end pcall(function() if EffectFolder and EffectFolder:FindFirstChild("Glow") then local glow = EffectFolder.Glow if glow:IsA("ParticleEmitter") then for _, limb in getLiveParts() do local clone = glow:Clone() clone.Enabled = true clone.Parent = limb Debris:AddItem(clone, 0.52) end end end end) end) task.delay(totalDuration, function() pcall(function() moveConn:Disconnect() end) pcall(function() fakeUpdateConn:Disconnect() end) pcall(function() camConn:Disconnect() end) if animSound and animSound.Parent then pcall(function() animSound:Stop() animSound:Destroy() end) end if animTrack then pcall(function() animTrack:Stop(0.3) end) end safeRestore() if hrp and hrp.Parent then local afterSound = Instance.new("Sound") afterSound.SoundId = "rbxassetid://97926606277706" afterSound.Volume = 1.5 afterSound.RollOffMaxDistance = 300 afterSound.Parent = hrp afterSound:Play() Debris:AddItem(afterSound, 10) end pcall(function() if EffectFolder and EffectFolder:FindFirstChild("LingeringAura") and character and character.Parent then for _, emitter in EffectFolder.LingeringAura:GetChildren() do if emitter and emitter:IsA("ParticleEmitter") then for _, n in {"Torso","UpperTorso","Left Arm","Right Arm"} do local p = character:FindFirstChild(n) if p and p:IsA("BasePart") then local clone = emitter:Clone() clone.Enabled = true clone.Parent = p Debris:AddItem(clone, 6) task.delay(4, function() if clone and clone.Parent then clone.Enabled = false end end) end end end end end end) pcall(function() if EffectFolder and EffectFolder:FindFirstChild("eyes") and head and head.Parent then for _, child in EffectFolder.eyes:GetChildren() do if child and child:IsA("Attachment") then local clone = child:Clone() clone.Parent = head for _, desc in clone:GetDescendants() do if desc and desc:IsA("ParticleEmitter") then desc.Enabled = true end end Debris:AddItem(clone, 6) task.delay(4, function() if clone and clone.Parent then for _, desc in clone:GetDescendants() do if desc and desc:IsA("ParticleEmitter") then desc.Enabled = false end end end end) end end end end) task.delay(0.3, function() if fakeChar and fakeChar.Parent then pcall(function() fakeChar:Destroy() end) end end) end) end) if not ok then safeRestore() end task.delay(20, function() if not hasRestored then safeRestore() end end) end local toolConnections = {} local function setupTool(tool) if not tool or toolConnections[tool] then return end toolConnections[tool] = true local function go() if hasActivated or isPlaying or not MainModule.FakeLightningAwakeningEnabled then return end hasActivated = true task.defer(function() activate() task.wait(0.5) hasActivated = false end) end tool.Equipped:Connect(go) tool.Activated:Connect(go) end local Tool = Instance.new("Tool") Tool.Name = "LIGHTNING AWAKENING" Tool.RequiresHandle = true Tool.CanBeDropped = false local Handle = Instance.new("Part") Handle.Name = "Handle" Handle.Size = Vector3.new(1, 1, 1) Handle.Transparency = 1 Handle.CanCollide = false Handle.Massless = true Handle.Parent = Tool local function giveTool() if not MainModule.FakeLightningAwakeningEnabled then return end local bp = LocalPlayer:FindFirstChild("Backpack") local char = LocalPlayer.Character if not bp then return end local inBackpack = bp:FindFirstChild("LIGHTNING AWAKENING") local inChar = char and char:FindFirstChild("LIGHTNING AWAKENING") if not inBackpack and not inChar then local t = Tool:Clone() t.Parent = bp setupTool(t) elseif inBackpack then setupTool(inBackpack) elseif inChar then setupTool(inChar) end end LocalPlayer:WaitForChild("Backpack") giveTool() LocalPlayer.Backpack.ChildAdded:Connect(function(child) if child.Name == "LIGHTNING AWAKENING" and child:IsA("Tool") then setupTool(child) end end) LocalPlayer.CharacterAdded:Connect(function(char) isPlaying, cooldown, hasActivated = false, false, false toolConnections = {} pcall(function() Camera.CameraType = Enum.CameraType.Custom Camera.FieldOfView = 70 end) task.wait(1) giveTool() char.ChildAdded:Connect(function(child) if child.Name == "LIGHTNING AWAKENING" and child:IsA("Tool") then setupTool(child) end end) end) --@encrypt_end end MainModule.ESPPowersEnabled = false MainModule.ESPPowersDrawings = {} MainModule.ESPPowersConnection = nil function MainModule.clear_esp_powers() for _, d in pairs(MainModule.ESPPowersDrawings) do pcall(function() if d.Remove then d:Remove() elseif d.Destroy then d:Destroy() end end) end MainModule.ESPPowersDrawings = {} if MainModule.ESPPowersConnection then pcall(function() MainModule.ESPPowersConnection:Disconnect() end) MainModule.ESPPowersConnection = nil end end function MainModule.toggle_esp_powers(enabled) MainModule.ESPPowersEnabled = enabled and true or false MainModule.clear_esp_powers() if not enabled then if PlayToggleSound then PlayToggleSound() end return true end local function getPowerName(plr) if not plr then return nil end local keys = {"_EquippedPower", "EquippedPower", "Power", "CurrentPower", "Ability"} for _, k in ipairs(keys) do local v = plr:GetAttribute(k) if v ~= nil and v ~= false and v ~= "" and v ~= 0 then return tostring(v) end end local c = plr.Character if c then for _, k in ipairs(keys) do local v = c:GetAttribute(k) if v ~= nil and v ~= false and v ~= "" and v ~= 0 then return tostring(v) end end for _, inst in ipairs(c:GetDescendants()) do if inst.Name == "_EquippedPower" or inst.Name == "EquippedPower" or inst.Name == "Power" then if inst:IsA("StringValue") or inst:IsA("NumberValue") then return tostring(inst.Value) end local av = inst:GetAttribute("Value") or inst:GetAttribute("Name") if av then return tostring(av) end end end end return nil end MainModule.ESPPowersConnection = RunService.RenderStepped:Connect(function() if not MainModule.ESPPowersEnabled then return end local cam = workspace.CurrentCamera if not cam then return end local used = {} for _, plr in ipairs(Players:GetPlayers()) do if plr ~= LocalPlayer and plr.Character then local powerName = getPowerName(plr) if powerName then local head = plr.Character:FindFirstChild("Head") or plr.Character:FindFirstChild("HumanoidRootPart") if head then local sp, onScreen = cam:WorldToViewportPoint(head.Position + Vector3.new(0, 2.2, 0)) local key = plr.UserId used[key] = true local text = MainModule.ESPPowersDrawings[key] if not text then text = Drawing.new("Text") text.Center = true text.Outline = true text.Size = 16 text.Font = 2 text.Color = Color3.fromRGB(255, 255, 255) text.OutlineColor = Color3.fromRGB(0, 0, 0) MainModule.ESPPowersDrawings[key] = text end if onScreen and sp.Z > 0 then text.Visible = true text.Position = Vector2.new(sp.X, sp.Y) text.Text = powerName else text.Visible = false end end end end end for key, text in pairs(MainModule.ESPPowersDrawings) do if not used[key] then pcall(function() if text.Remove then text:Remove() end end) MainModule.ESPPowersDrawings[key] = nil end end end) if PlayToggleSound then PlayToggleSound() end return true end MainModule.PeabertESPEnabled = false MainModule.PeabertESPHighlights = {} MainModule.PeabertESPTracers = {} MainModule.PeabertESPConnection = nil MainModule.PeabertTargetsCache = {} MainModule.PeabertLastScan = 0 local function clearPeabertESP() for _, h in pairs(MainModule.PeabertESPHighlights) do pcall(function() if h and h.Parent then h:Destroy() end end) end MainModule.PeabertESPHighlights = {} for _, t in pairs(MainModule.PeabertESPTracers) do pcall(function() if t.Remove then t:Remove() elseif t.Destroy then t:Destroy() end end) end MainModule.PeabertESPTracers = {} end local function isPeabertTarget(obj) if not obj then return false end if obj:FindFirstChild("Dead") then return false end local n = obj.Name local low = n:lower() if low == "freepeabert" or low:find("freepeabert") then return true end local free = false pcall(function() free = obj:GetAttribute("FREEPEABERT") or obj:GetAttribute("FreePeabert") end) if free then return true end if low:match("^peabert%d+$") then return true end if low:match("^peabert_%d+$") then return true end if low:match("^evilpeabert1_%d+$") then return true end if low:match("^peabertspawn%d+$") then return true end if low:match("^peabertshattered%d+$") then return true end if low:match("^peabertcrack%d+$") then return true end if low == "peabert" or (low:find("peabert") and not low:find("esp")) then return true end return false end local function getPeabertPart(obj) if obj:IsA("BasePart") then return obj end if obj:IsA("Model") then return obj.PrimaryPart or obj:FindFirstChild("HumanoidRootPart") or obj:FindFirstChild("Head") or obj:FindFirstChildWhichIsA("BasePart") end return obj:FindFirstChildWhichIsA("BasePart") end local function scanPeaberts() local targets = {} local seen = {} local function add(obj) if not obj or seen[obj] then return end if not isPeabertTarget(obj) then return end local part = getPeabertPart(obj) if not part then return end seen[obj] = true table.insert(targets, { Object = obj, Part = part, Name = obj.Name }) end local live = workspace:FindFirstChild("Live") if live then for i = 1, 10 do add(live:FindFirstChild("FREEPEABERT")) add(live:FindFirstChild("FreePeabert")) add(live:FindFirstChild("FreePeabert" .. i)) add(live:FindFirstChild("Peabert" .. i)) add(live:FindFirstChild("Peabert_" .. i)) add(live:FindFirstChild("EvilPeabert1_" .. i)) add(live:FindFirstChild("PeabertSpawn" .. i)) end for _, child in ipairs(live:GetChildren()) do local n = child.Name:lower() if n:find("peabert") or n:find("freepeabert") then add(child) end end end -- light pass: only direct children named like peabert (no full GetDescendants) for _, child in ipairs(workspace:GetChildren()) do local n = child.Name:lower() if n:find("peabert") then add(child) for _, sub in ipairs(child:GetChildren()) do add(sub) end end end MainModule.PeabertTargetsCache = targets MainModule.PeabertLastScan = tick() end function MainModule.start_peabert_esp() if MainModule.PeabertESPEnabled then return end MainModule.PeabertESPEnabled = true clearPeabertESP() scanPeaberts() MainModule.PeabertESPConnection = RunService.Heartbeat:Connect(function() if not MainModule.PeabertESPEnabled then return end if tick() - MainModule.PeabertLastScan > 2.5 then scanPeaberts() end local cam = workspace.CurrentCamera local myRoot = LocalPlayer.Character and LocalPlayer.Character:FindFirstChild("HumanoidRootPart") local used = {} local fromPos = Vector2.new(0, 0) if cam then fromPos = Vector2.new(cam.ViewportSize.X / 2, cam.ViewportSize.Y) end if myRoot and cam then local sp = cam:WorldToViewportPoint(myRoot.Position) fromPos = Vector2.new(sp.X, sp.Y) end for _, data in ipairs(MainModule.PeabertTargetsCache) do local part = data.Part local name = data.Name local key = tostring(data.Object) if part and part.Parent then used[key] = true local hl = MainModule.PeabertESPHighlights[key] if not hl or not hl.Parent then hl = Instance.new("Highlight") hl.Name = "PeabertHighlight" hl.FillColor = Color3.fromRGB(255, 105, 180) hl.OutlineColor = Color3.fromRGB(255, 182, 193) hl.FillTransparency = 0.4 hl.OutlineTransparency = 0 local adornee = data.Object:IsA("Model") and data.Object or part hl.Adornee = adornee hl.Parent = adornee MainModule.PeabertESPHighlights[key] = hl else hl.Adornee = data.Object:IsA("Model") and data.Object or part end local dist = myRoot and (part.Position - myRoot.Position).Magnitude or 0 local tracer = MainModule.PeabertESPTracers[key] if dist > 500 then if tracer then tracer.Visible = false end else if not tracer then tracer = Drawing.new("Line") tracer.Thickness = 1.5 tracer.Color = Color3.fromRGB(255, 105, 180) tracer.Transparency = 1 MainModule.PeabertESPTracers[key] = tracer end if cam then local sp2, onScreen = cam:WorldToViewportPoint(part.Position) if onScreen and sp2.Z > 0 then tracer.Visible = true tracer.From = fromPos tracer.To = Vector2.new(sp2.X, sp2.Y) else tracer.Visible = false end end end end end for key, hl in pairs(MainModule.PeabertESPHighlights) do if not used[key] then pcall(function() if hl and hl.Parent then hl:Destroy() end end) MainModule.PeabertESPHighlights[key] = nil end end for key, tr in pairs(MainModule.PeabertESPTracers) do if not used[key] then pcall(function() if tr.Remove then tr:Remove() end end) MainModule.PeabertESPTracers[key] = nil end end end) if MainModule.notify then end if PlayToggleSound then PlayToggleSound() end return true end function MainModule.stop_peabert_esp() if not MainModule.PeabertESPEnabled then return end MainModule.PeabertESPEnabled = false if MainModule.PeabertESPConnection then pcall(function() MainModule.PeabertESPConnection:Disconnect() end) MainModule.PeabertESPConnection = nil end clearPeabertESP() if PlayToggleSound then PlayToggleSound() end end function MainModule.toggle_peabert_esp(state) if state then return MainModule.start_peabert_esp() else MainModule.stop_peabert_esp() return true end end function MainModule.tp_to_peaberts() local character = LocalPlayer.Character if not character then return end local hrp = character:FindFirstChild("HumanoidRootPart") if not hrp then return end scanPeaberts() local targets = MainModule.PeabertTargetsCache if #targets == 0 then if MainModule.notify then MainModule.notify("Peabert TP", "No Peaberts found on map!", 1.5) end return end local best, bestDist = nil, math.huge for _, data in ipairs(targets) do local part = data.Part if part and part.Parent then local n = data.Name:lower() local priority = 2 if n:find("freepeabert") or n == "freepeabert" then priority = 0 elseif n:match("^peabert%d+$") or n:match("^peabert_%d+$") then priority = 1 end local d = (part.Position - hrp.Position).Magnitude + priority * 0.001 if d < bestDist then best, bestDist = part, d end end end if not best then if MainModule.notify then MainModule.notify("Peabert TP", "No Peaberts found on map!", 1.5) end return end hrp.CFrame = CFrame.new(best.Position + Vector3.new(0, 4, 0)) if MainModule.notify then MainModule.notify("Peabert TP", "Teleported to Peabert!", 1.2) end end MainModule.AddVisualItemsEnabled = false MainModule.AddVisualItemsConnection = nil MainModule.AutoWinEnabled = false MainModule.AutoWinConnection = nil MainModule.AutoWinTriggered = {} MainModule.CurrentGame = nil MainModule.GameStartTime = nil MainModule.LastNotifTime = 0 MainModule.AutoWinHunterFeatures = false MainModule.set_auto_win_hunter_features = function(enabled) enabled = enabled and true or false if MainModule.AutoWinHunterFeatures == enabled then return end MainModule.AutoWinHunterFeatures = enabled if MainModule.PlayerAttachEnabled ~= enabled then MainModule.toggle_player_attach(enabled) end if MainModule.FaceTargetModule and MainModule.FaceTargetModule.Enabled ~= enabled then MainModule.toggle_face_target(enabled) end if MainModule.SpikesKillFeature and MainModule.SpikesKillFeature.Enabled ~= enabled then MainModule.toggle_spikes_kill(enabled) end MainModule.toggle_noclip(enabled) if MainModule.ToggleRefs then if MainModule.ToggleRefs.PlayerAttach then MainModule.ToggleRefs.PlayerAttach:SetValue(enabled) end if MainModule.ToggleRefs.FaceTarget then MainModule.ToggleRefs.FaceTarget:SetValue(enabled) end if MainModule.ToggleRefs.SpikesKill then MainModule.ToggleRefs.SpikesKill:SetValue(enabled) end if MainModule.ToggleRefs.Noclip then MainModule.ToggleRefs.Noclip:SetValue(enabled) end end end local getupvalues = (debug and (debug.getupvalues or debug.get_upvalues)) or getupvalues local setupvalue = (debug and (debug.setupvalue or debug.setup_value)) or setupvalue local getconstants = (debug and (debug.getconstants or debug.get_constants)) or getconstants local function forceProgress100() if not getgc or not getupvalues or not setupvalue then return false end local patched = false local ok, list = pcall(function() return getgc() end) if not ok or type(list) ~= "table" then return false end for _, fn in ipairs(list) do if type(fn) == "function" then local consts = nil if getconstants then local constantsOk, result = pcall(function() return getconstants(fn) end) if constantsOk then consts = result end end local useful = false if type(consts) == "table" then for _, constant in pairs(consts) do if constant == "Progress" or constant == "Completed" then useful = true break end if type(constant) == "string" and constant:find("%%", 1, true) then useful = true break end end end if useful then local upvaluesOk, ups = pcall(function() return getupvalues(fn) end) if upvaluesOk and type(ups) == "table" then for index, value in pairs(ups) do if type(value) == "number" and value == value and value >= 0 and value < 5000 then local patchedOk = pcall(function() setupvalue(fn, index, 100000) end) if patchedOk then patched = true end end end end end end end return patched end loadstring([[ function LPH_NO_VIRTUALIZE(f) return f end; ]])(); loadstring([[ function LPH_NO_VIRTUALIZE(f) return f end; ]])(); --@encrypt_end --@encrypt_start loadstring([[ function LPH_NO_VIRTUALIZE(f) return f end; ]])(); MainModule.complete_dalgona = function() task.spawn(function() local success = false for _ = 1, 10 do if forceProgress100() then success = true end task.wait(0.15) end if success then pcall(function() HSXNotify("Dalgona", "Dalgona Completed", 0.9) end) else pcall(function() HSXNotify("Dalgona", "Failed (no hooks?)", 0.9) end) end end) end --@encrypt_end MainModule.cleanup_auto_win_game = function(gameName) if gameName == "HideAndSeek" then MainModule.set_auto_win_hunter_features(false) end if gameName == "Rebel" and MainModule.RebelEnabled then MainModule.toggle_rebel_v2(false) end if gameName == "TugOfWar" or gameName == "TugofWar" then if MainModule.TugOfWarUltraFastPull then MainModule.toggle_tug_of_war_ultra_fast_pull(false) end end end MainModule.auto_win = function() if not MainModule.AutoWinEnabled then return end local currentTime = tick() local values = Workspace:FindFirstChild("Values") if not values then return end local currentGameValue = values:FindFirstChild("CurrentGame") if not currentGameValue then return end local currentGame = currentGameValue.Value if not currentGame or currentGame == "" then return end if currentGame ~= MainModule.CurrentGame then local oldGame = MainModule.CurrentGame if oldGame then MainModule.cleanup_auto_win_game(oldGame) end MainModule.CurrentGame = currentGame MainModule.GameStartTime = currentTime MainModule.AutoWinTriggered = { Main = false, HunterStarted = false, HunterStopped = false, RebelStarted = false, TugOfWarStarted = false } return end if not MainModule.GameStartTime then MainModule.GameStartTime = currentTime return end local elapsed = currentTime - MainModule.GameStartTime local state = MainModule.AutoWinTriggered if currentGame == "TugOfWar" or currentGame == "TugofWar" then if not state.TugOfWarStarted then state.TugOfWarStarted = true if not MainModule.TugOfWarUltraFastPull then MainModule.toggle_tug_of_war_ultra_fast_pull(true) end PlayBell() end return end local character = MainModule.get_character() if not character then return end local rootPart = MainModule.get_root_part(character) if not rootPart then return end if currentGame == "RedLightGreenLight" then if not state.Main and elapsed >= 15 then state.Main = true MainModule.safe_teleport( Vector3.new(-214.4, 1023.1, 146.7) ) PlayBell() end elseif currentGame == "Dalgona" then if not state.Main and elapsed >= 25 then state.Main = true MainModule.complete_dalgona() PlayBell() end elseif currentGame == "LightsOut" or currentGame == "LightOut" then if not state.Main and elapsed >= 15 then state.Main = true local pos = rootPart.Position MainModule.safe_teleport( Vector3.new(pos.X, pos.Y + 100, pos.Z) ) PlayBell() end elseif currentGame == "HideAndSeek" then local isHider = MainModule.is_hider(LocalPlayer) local isHunter = MainModule.is_seeker(LocalPlayer) if isHider then if not state.Main and elapsed >= 15 then state.Main = true local pos = rootPart.Position MainModule.safe_teleport( Vector3.new(pos.X, pos.Y + 200, pos.Z) ) PlayBell() end elseif isHunter then if not state.HunterStarted and elapsed >= 25 then state.HunterStarted = true MainModule.set_auto_win_hunter_features(true) PlayBell() end if state.HunterStarted and not state.HunterStopped and elapsed >= 145 then state.HunterStopped = true MainModule.set_auto_win_hunter_features(false) PlayBell() end end elseif currentGame == "JumpRope" then if not state.Main and elapsed >= 15 then state.Main = true MainModule.safe_teleport( Vector3.new( 720.896057, 198.628311, 921.170654 ) ) PlayBell() end elseif currentGame == "GlassBridge" then if not state.Main and elapsed >= 15 then state.Main = true MainModule.safe_teleport( Vector3.new( -196.372467, 522.192139, -1534.20984 ) ) PlayBell() end elseif currentGame == "Rebel" then if not state.RebelStarted then state.RebelStarted = true local pos = rootPart.Position MainModule.safe_teleport( Vector3.new(pos.X, pos.Y + 100, pos.Z) ) if not MainModule.RebelEnabled then MainModule.toggle_rebel_v2(true) end PlayBell() end end end MainModule.toggle_auto_win = function(enabled) enabled = enabled and true or false MainModule.AutoWinEnabled = enabled if MainModule.AutoWinConnection then MainModule.AutoWinConnection:Disconnect() MainModule.AutoWinConnection = nil end if not enabled then MainModule.cleanup_auto_win_game(MainModule.CurrentGame) MainModule.set_auto_win_hunter_features(false) if MainModule.TugOfWarUltraFastPull then MainModule.toggle_tug_of_war_ultra_fast_pull(false) end if MainModule.RebelEnabled then MainModule.toggle_rebel_v2(false) end end MainModule.AutoWinTriggered = {} MainModule.CurrentGame = nil MainModule.GameStartTime = nil MainModule.LastNotifTime = 0 if enabled then MainModule.AutoWinConnection = RunService.Heartbeat:Connect(function() MainModule.auto_win() end) end PlayToggleSound() return true end getgenv().Time = 3 getgenv().Head = {1095708} getgenv().Hand = {3141364957} getgenv().Torso = {2222720521} local function findMyCharacter() local camera = workspace.CurrentCamera if camera and camera.CameraSubject then local subject = camera.CameraSubject if subject and subject:IsA("Humanoid") then return subject.Parent end end for _, obj in pairs(workspace:GetChildren()) do if obj:FindFirstChild("Humanoid") and obj:FindFirstChild("Head") then if not string.find(obj.Name:lower(), "badpreload") and not string.find(obj.Name:lower(), "preload") then return obj end end end return nil end local function addAccessory(accessoryId, parentPart) local success, accessory = pcall(function() return game:GetObjects("rbxassetid://" .. tostring(accessoryId))[1] end) if success and accessory then local handle = accessory:FindFirstChild("Handle") if handle then local accessoryAttachment = handle:FindFirstChildOfClass("Attachment") if accessoryAttachment then local parentAttachment = parentPart:FindFirstChild(accessoryAttachment.Name) if parentAttachment then local weld = Instance.new("Weld") weld.Part0 = parentPart weld.Part1 = handle weld.C0 = parentAttachment.CFrame weld.C1 = accessoryAttachment.CFrame weld.Parent = handle else local weld = Instance.new("Weld") weld.Part0 = parentPart weld.Part1 = handle weld.C0 = CFrame.new() weld.C1 = CFrame.new() weld.Parent = handle end else local weld = Instance.new("Weld") weld.Part0 = parentPart weld.Part1 = handle weld.C0 = CFrame.new() weld.C1 = CFrame.new() weld.Parent = handle end handle.CanCollide = false accessory.Parent = parentPart.Parent print("Added to u: " .. tostring(accessoryId)) else warn("No Handle found in accessory: " .. tostring(accessoryId)) end else warn("Failed to load accessory: " .. tostring(accessoryId)) end end local function ApplyHeadless(character) local head = character:FindFirstChild("Head") if not head then return end head.Transparency = 1 head.CanCollide = false local face = head:FindFirstChildOfClass("Decal") if face then face:Destroy() end for _, v in ipairs(head:GetChildren()) do if v:IsA("SpecialMesh") or v:IsA("CharacterMesh") then v:Destroy() end end local mesh = Instance.new("SpecialMesh") mesh.MeshType = Enum.MeshType.FileMesh mesh.MeshId = "rbxassetid://1095708" mesh.Scale = Vector3.new(0.001, 0.001, 0.001) mesh.Parent = head end local function ApplyKorblox(character) local rightLeg = character:FindFirstChild("Right Leg") if not rightLeg then return end for _, v in ipairs(rightLeg:GetChildren()) do if v:IsA("SpecialMesh") or v:IsA("CharacterMesh") then v:Destroy() end end local mesh = Instance.new("SpecialMesh") mesh.MeshType = Enum.MeshType.FileMesh mesh.MeshId = "rbxassetid://3141364957" mesh.TextureId = "rbxassetid://3141364957" mesh.Scale = Vector3.new(1, 1, 1) mesh.Parent = rightLeg end local function AddVisualItems() local character = findMyCharacter() if not character then return end if character:FindFirstChild("Head") then for _, id in ipairs(getgenv().Head) do addAccessory(id, character.Head) task.wait(0.3) end end local torso = character:FindFirstChild("UpperTorso") or character:FindFirstChild("Torso") if torso then for _, id in ipairs(getgenv().Torso) do addAccessory(id, torso) task.wait(0.3) end end local hand = character:FindFirstChild("RightHand") or character:FindFirstChild("LeftHand") if not hand then hand = character:FindFirstChild("Right Arm") or character:FindFirstChild("Left Arm") end if hand and getgenv().Hand then for _, id in ipairs(getgenv().Hand) do addAccessory(id, hand) task.wait(0.3) end end ApplyHeadless(character) end function MainModule.toggle_visual_items(enabled) MainModule.AddVisualItemsEnabled = enabled if MainModule.AddVisualItemsConnection then MainModule.AddVisualItemsConnection:Disconnect() MainModule.AddVisualItemsConnection = nil end if enabled then AddVisualItems() MainModule.AddVisualItemsConnection = LocalPlayer.CharacterAdded:Connect(function(character) task.wait(1) if MainModule.AddVisualItemsEnabled then AddVisualItems() end end) end PlayToggleSound() end local noclippizdaEnabled = false local originalStates = {} local connections = {} local function isWall(part) local name = part.Name:lower() if name:find("wall") then return true end if part.Size.Y > part.Size.X or part.Size.Y > part.Size.Z then return true end return false end local function isFloor(part) local name = part.Name:lower() if name:find("floor") or name:find("ground") or name:find("plate") then return true end if part.Size.Y < part.Size.X and part.Size.Y < part.Size.Z then return true end return false end local function processPart(part) if not part:IsA("BasePart") then return end local character = LocalPlayer.Character if character and part:IsDescendantOf(character) then return end if originalStates[part] == nil then originalStates[part] = part.CanCollide end if noclippizdaEnabled then if isFloor(part) then part.CanCollide = true elseif isWall(part) then part.CanCollide = false end else part.CanCollide = originalStates[part] end end local function applyToAll() for _, obj in ipairs(Workspace:GetDescendants()) do processPart(obj) end end local function enableNoclip() noclippizdaEnabled = true applyToAll() table.insert(connections, Workspace.DescendantAdded:Connect(function(obj) if noclippizdaEnabled then processPart(obj) end end)) end local function disableNoclip() noclippizdaEnabled = false for _, conn in ipairs(connections) do pcall(function() conn:Disconnect() end) end table.clear(connections) for part, original in pairs(originalStates) do if part and part.Parent then pcall(function() part.CanCollide = original end) end end table.clear(originalStates) end MainModule.toggle_noclip = function(enabled) enabled = enabled and true or false if enabled then enableNoclip() else disableNoclip() end PlayToggleSound() return true end MainModule.FreeCam = { Enabled = false, Camera = nil, OriginalCameraType = nil, OriginalCameraSubject = nil, OriginalCFrame = nil, Speed = 10, Sensitivity = 0.25, Keys = {W=false, S=false, A=false, D=false, Q=false, E=false}, Connection = nil, HeartbeatConnection = nil, InputBegan = nil, InputEnded = nil, Yaw = 0, Pitch = 0 } MainModule.set_free_cam_speed = function(v) local n = tonumber(v) or 10 MainModule.FreeCam.Speed = n end MainModule.toggle_free_cam = function(enabled) if enabled then if MainModule.FreeCam.Enabled then return end MainModule.FreeCam.Enabled = true local cam = workspace.CurrentCamera local char = LocalPlayer.Character local rootPart = char and char:FindFirstChild("HumanoidRootPart") MainModule.FreeCam.OriginalCameraType = cam.CameraType MainModule.FreeCam.OriginalCameraSubject = cam.CameraSubject MainModule.FreeCam.OriginalCFrame = cam.CFrame MainModule.FreeCam.Camera = cam if rootPart then MainModule.FreeCam.OriginalPosition = rootPart.CFrame end cam.CameraType = Enum.CameraType.Scriptable cam.CFrame = MainModule.FreeCam.OriginalCFrame do local lv = cam.CFrame.LookVector MainModule.FreeCam.Yaw = math.atan2(-lv.X, -lv.Z) MainModule.FreeCam.Pitch = math.asin(math.clamp(lv.Y, -1, 1)) end pcall(function() UserInputService.MouseBehavior = Enum.MouseBehavior.LockCenter end) pcall(function() UserInputService.MouseIconEnabled = false end) if char then local hum = char:FindFirstChildOfClass("Humanoid") if hum then hum.AutoRotate = false hum.PlatformStand = true end if rootPart then rootPart.Anchored = true end end local function updateFreeCam() if not MainModule.FreeCam.Enabled then return end local cam = MainModule.FreeCam.Camera if not cam then return end local delta = UserInputService:GetMouseDelta() local sens = MainModule.FreeCam.Sensitivity or 0.25 MainModule.FreeCam.Yaw = MainModule.FreeCam.Yaw - delta.X * sens * 0.012 MainModule.FreeCam.Pitch = math.clamp(MainModule.FreeCam.Pitch - delta.Y * sens * 0.012, -1.45, 1.45) local rot = CFrame.fromEulerAnglesYXZ(MainModule.FreeCam.Pitch, MainModule.FreeCam.Yaw, 0) local pos = cam.CFrame.Position local move = Vector3.zero if MainModule.FreeCam.Keys.W then move = move + rot.LookVector end if MainModule.FreeCam.Keys.S then move = move - rot.LookVector end if MainModule.FreeCam.Keys.D then move = move + rot.RightVector end if MainModule.FreeCam.Keys.A then move = move - rot.RightVector end if MainModule.FreeCam.Keys.Q then move = move - Vector3.yAxis end if MainModule.FreeCam.Keys.E then move = move + Vector3.yAxis end if move.Magnitude > 0 then pos = pos + move.Unit * (MainModule.FreeCam.Speed or 10) end cam.CFrame = CFrame.new(pos) * rot end local inputBegan = UserInputService.InputBegan:Connect(function(input, gp) if gp then return end local k = input.KeyCode if k == Enum.KeyCode.W then MainModule.FreeCam.Keys.W = true elseif k == Enum.KeyCode.S then MainModule.FreeCam.Keys.S = true elseif k == Enum.KeyCode.A then MainModule.FreeCam.Keys.A = true elseif k == Enum.KeyCode.D then MainModule.FreeCam.Keys.D = true elseif k == Enum.KeyCode.Q then MainModule.FreeCam.Keys.Q = true elseif k == Enum.KeyCode.E then MainModule.FreeCam.Keys.E = true elseif k == Enum.KeyCode.LeftShift then MainModule.FreeCam.Speed = (MainModule.FreeCam.Speed or 10) * 2 elseif k == Enum.KeyCode.LeftControl then MainModule.FreeCam.Speed = math.max(1, (MainModule.FreeCam.Speed or 10) * 0.4) end end) local inputEnded = UserInputService.InputEnded:Connect(function(input) local k = input.KeyCode if k == Enum.KeyCode.W then MainModule.FreeCam.Keys.W = false elseif k == Enum.KeyCode.S then MainModule.FreeCam.Keys.S = false elseif k == Enum.KeyCode.A then MainModule.FreeCam.Keys.A = false elseif k == Enum.KeyCode.D then MainModule.FreeCam.Keys.D = false elseif k == Enum.KeyCode.Q then MainModule.FreeCam.Keys.Q = false elseif k == Enum.KeyCode.E then MainModule.FreeCam.Keys.E = false elseif k == Enum.KeyCode.LeftShift or k == Enum.KeyCode.LeftControl then MainModule.FreeCam.Speed = MainModule.FreeCam._BaseSpeed or MainModule.FreeCam.Speed or 10 end end) MainModule.FreeCam._BaseSpeed = MainModule.FreeCam.Speed MainModule.FreeCam.Connection = RunService.RenderStepped:Connect(updateFreeCam) MainModule.FreeCam.InputBegan = inputBegan MainModule.FreeCam.InputEnded = inputEnded HSXNotify("FreeCam", "Mouse look + WASD/QE | Shift fast / Ctrl slow", 0.9) else if not MainModule.FreeCam.Enabled then return end MainModule.FreeCam.Enabled = false if MainModule.FreeCam.Connection then MainModule.FreeCam.Connection:Disconnect() MainModule.FreeCam.Connection = nil end if MainModule.FreeCam.InputBegan then MainModule.FreeCam.InputBegan:Disconnect() MainModule.FreeCam.InputBegan = nil end if MainModule.FreeCam.InputEnded then MainModule.FreeCam.InputEnded:Disconnect() MainModule.FreeCam.InputEnded = nil end pcall(function() UserInputService.MouseBehavior = Enum.MouseBehavior.Default end) pcall(function() UserInputService.MouseIconEnabled = true end) local cam = MainModule.FreeCam.Camera if cam then cam.CameraType = MainModule.FreeCam.OriginalCameraType or Enum.CameraType.Custom if MainModule.FreeCam.OriginalCameraSubject then cam.CameraSubject = MainModule.FreeCam.OriginalCameraSubject end end local char = LocalPlayer.Character if char then local hum = char:FindFirstChildOfClass("Humanoid") if hum then hum.AutoRotate = true hum.PlatformStand = false end local rootPart = char:FindFirstChild("HumanoidRootPart") if rootPart then rootPart.Anchored = false if MainModule.FreeCam.OriginalPosition then rootPart.CFrame = MainModule.FreeCam.OriginalPosition end end end end PlayToggleSound() end MainModule.QuicksilverEnabled = false MainModule.QuicksilverFolder = nil MainModule.toggle_quicksilver = function(enabled) enabled = enabled and true or false MainModule.QuicksilverEnabled = enabled if enabled then pcall(function() local live = Workspace:FindFirstChild("Live") or Workspace:WaitForChild("Live", 5) if not live then return end local target = live:FindFirstChild(LocalPlayer.Name) or live:WaitForChild(LocalPlayer.Name, 5) if not target then return end local existing = target:FindFirstChild("IsWallyWest") if existing then existing:Destroy() end local folder = Instance.new("Folder") folder.Name = "IsWallyWest" folder.Parent = target MainModule.QuicksilverFolder = folder end) HSXNotify("Quicksilver", "Enabled", 0.8) else pcall(function() if MainModule.QuicksilverFolder and MainModule.QuicksilverFolder.Parent then MainModule.QuicksilverFolder:Destroy() end MainModule.QuicksilverFolder = nil local live = Workspace:FindFirstChild("Live") local target = live and live:FindFirstChild(LocalPlayer.Name) if target then local f = target:FindFirstChild("IsWallyWest") if f then f:Destroy() end end end) HSXNotify("Quicksilver", "Disabled", 0.8) end PlayToggleSound() return true end MainModule.RemoveAnniversaryEnabled = false MainModule.RemoveAnniversaryTask = nil MainModule.AnniversaryFolders = { "GameplayLobbyForAnniversary", "RedLightGreenLightAnniversary", "JumpropeAnniversary", "Anniversary", "LobbyAnniversary", "MapAnniversary", "HideAndSeekAnniversary", "DalgonaAnniversary", "SkySquidGameAnniversary", "SquidGameAnniversary", "GlassBridgeAnniversary", "TugOfWarAnniversary", "LightsOutEffectBind", } local function removeAnniversaryOnce() for _, name in ipairs(MainModule.AnniversaryFolders) do local obj = workspace:FindFirstChild(name) if obj then pcall(function() obj:Destroy() end) end end local effects = workspace:FindFirstChild("Effects") if effects then local blood = effects:FindFirstChild("BloodSplatter") if blood then pcall(function() blood:Destroy() end) end end end function MainModule.toggle_remove_anniversary(enabled) enabled = enabled and true or false MainModule.RemoveAnniversaryEnabled = enabled if MainModule.RemoveAnniversaryTask then task.cancel(MainModule.RemoveAnniversaryTask) MainModule.RemoveAnniversaryTask = nil end if enabled then removeAnniversaryOnce() MainModule.RemoveAnniversaryTask = task.spawn(function() while MainModule.RemoveAnniversaryEnabled do task.wait(10) if not MainModule.RemoveAnniversaryEnabled then break end removeAnniversaryOnce() end MainModule.RemoveAnniversaryTask = nil end) HSXNotify("Anniversary", "Decor removal ON", 0.8) else HSXNotify("Anniversary", "Decor removal OFF", 0.8) end PlayToggleSound() return true end MainModule.FakeExploiterEnabled = false MainModule.FakeExploiter = { isActive = false, currentTarget = nil, fakeChar = nil, hideConn = nil, seqTask = nil, originalNametag = nil, nametagParent = nil, watchdog = nil, } local FE_ANIMS = { Startup = "rbxassetid://135801672920476", Sprint = "rbxassetid://82609803681213", Jump = "rbxassetid://130659228300247", Fall = "rbxassetid://112693580156198" } function MainModule.FakeExploiter_getNearest() local dist = math.huge local target = nil local myChar = LocalPlayer.Character local myHRP = myChar and myChar:FindFirstChild("HumanoidRootPart") if not myHRP then return nil end for _, p in ipairs(Players:GetPlayers()) do if p ~= LocalPlayer and p.Character then local hrp = p.Character:FindFirstChild("HumanoidRootPart") local hum = p.Character:FindFirstChild("Humanoid") if hrp and hum and hum.Health > 0 then local d = (hrp.Position - myHRP.Position).Magnitude if d < dist then dist = d target = p end end end end return target end function MainModule.FakeExploiter_setHidden(char, hidden) if not char then return end for _, v in ipairs(char:GetDescendants()) do if v:IsA("BasePart") or v:IsA("Decal") or v:IsA("Texture") then if v.Name ~= "Player_Nametag" and not v:FindFirstAncestor("Player_Nametag") then v.LocalTransparencyModifier = hidden and 1 or 0 end elseif v:IsA("Accessory") then local handle = v:FindFirstChild("Handle") if handle then handle.LocalTransparencyModifier = hidden and 1 or 0 end end end end function MainModule.FakeExploiter_findNametag(char) if not char then return nil end local torso = char:FindFirstChild("Torso") or char:FindFirstChild("UpperTorso") if torso then local tag = torso:FindFirstChild("Player_Nametag") if tag then return tag, torso end end for _, v in ipairs(char:GetDescendants()) do if v.Name == "Player_Nametag" then return v, v.Parent end end return nil, nil end function MainModule.FakeExploiter_moveNametag(realChar, fake) local FE = MainModule.FakeExploiter local tag, parent = MainModule.FakeExploiter_findNametag(realChar) if not tag or not fake then return end FE.originalNametag = tag FE.nametagParent = parent local fakeTorso = fake:FindFirstChild("Torso") or fake:FindFirstChild("UpperTorso") if not fakeTorso then return end tag.Parent = fakeTorso end function MainModule.FakeExploiter_restoreNametag() local FE = MainModule.FakeExploiter if FE.originalNametag and FE.nametagParent and FE.originalNametag.Parent then pcall(function() FE.originalNametag.Parent = FE.nametagParent end) end FE.originalNametag = nil FE.nametagParent = nil end function MainModule.FakeExploiter_turnOff() local FE = MainModule.FakeExploiter FE.isActive = false if FE.seqTask then task.cancel(FE.seqTask) FE.seqTask = nil end if FE.hideConn then FE.hideConn:Disconnect() FE.hideConn = nil end if FE.watchdog then FE.watchdog:Disconnect() FE.watchdog = nil end MainModule.FakeExploiter_restoreNametag() if FE.currentTarget and FE.currentTarget.Character then MainModule.FakeExploiter_setHidden(FE.currentTarget.Character, false) end if FE.fakeChar and FE.fakeChar.Parent then FE.fakeChar:Destroy() end FE.currentTarget = nil FE.fakeChar = nil end function MainModule.FakeExploiter_activate() local FE = MainModule.FakeExploiter local myChar = LocalPlayer.Character local myHRP = myChar and myChar:FindFirstChild("HumanoidRootPart") if not myHRP then MainModule.FakeExploiter_turnOff() return end if not FE.currentTarget then MainModule.FakeExploiter_turnOff() return end local realChar = FE.currentTarget.Character if not realChar then MainModule.FakeExploiter_turnOff() return end local realHRP = realChar:FindFirstChild("HumanoidRootPart") if not realHRP then MainModule.FakeExploiter_turnOff() return end local wasArchivable = realChar.Archivable realChar.Archivable = true FE.fakeChar = realChar:Clone() realChar.Archivable = wasArchivable for _, v in ipairs(FE.fakeChar:GetDescendants()) do if v:IsA("Script") or v:IsA("LocalScript") then v:Destroy() elseif v.Name == "Player_Nametag" then v:Destroy() end end local fakeHRP = FE.fakeChar:FindFirstChild("HumanoidRootPart") local fakeHum = FE.fakeChar:FindFirstChild("Humanoid") if not fakeHRP or not fakeHum then FE.fakeChar:Destroy() MainModule.FakeExploiter_turnOff() return end fakeHRP.Anchored = true fakeHRP.CFrame = realHRP.CFrame FE.fakeChar.Parent = workspace MainModule.FakeExploiter_moveNametag(realChar, FE.fakeChar) local animator = fakeHum:FindFirstChildOfClass("Animator") or Instance.new("Animator", fakeHum) local function loadAnim(id) local a = Instance.new("Animation") a.AnimationId = id return animator:LoadAnimation(a) end local trStartup = loadAnim(FE_ANIMS.Startup) local trSprint = loadAnim(FE_ANIMS.Sprint) local trJump = loadAnim(FE_ANIMS.Jump) local trFall = loadAnim(FE_ANIMS.Fall) trStartup.Priority = Enum.AnimationPriority.Action4 trSprint.Priority = Enum.AnimationPriority.Action4 trJump.Priority = Enum.AnimationPriority.Action4 trFall.Priority = Enum.AnimationPriority.Action4 FE.hideConn = RunService.RenderStepped:Connect(function() if FE.currentTarget and FE.currentTarget.Character then MainModule.FakeExploiter_setHidden(FE.currentTarget.Character, true) end end) FE.seqTask = task.spawn(function() trStartup:Play() task.wait(0.4) trStartup:Stop(0.2) trSprint:Play() local t = 0 while t < 2.5 and FE.isActive do local dt = task.wait() t += dt if not myHRP or not myHRP.Parent or not fakeHRP or not fakeHRP.Parent then break end local targetPos = myHRP.Position + Vector3.new(math.sin(t * 10) * 16, 0, math.cos(t * 10) * 16) local lookAt = CFrame.lookAt(fakeHRP.Position, targetPos + Vector3.new(0, 0.1, 0)) fakeHRP.CFrame = lookAt * CFrame.new(0, 0, -55 * dt) fakeHRP.CFrame = CFrame.new(fakeHRP.Position.X, myHRP.Position.Y, fakeHRP.Position.Z) * fakeHRP.CFrame.Rotation end trSprint:Stop(0.2) trJump:Play() t = 0 while t < 0.45 and FE.isActive do local dt = task.wait() t += dt if not fakeHRP or not fakeHRP.Parent then break end fakeHRP.CFrame = fakeHRP.CFrame * CFrame.new(0, 28 * dt, -12 * dt) end trJump:Stop(0.2) trFall:Play() local angle = 0 while FE.isActive do local dt = task.wait() angle += dt * 6 if not myHRP or not myHRP.Parent or not fakeHRP or not fakeHRP.Parent then break end local radius = 18 + math.sin(angle * 1.5) * 8 local height = 8 + math.cos(angle * 1.2) * 5 local targetPos = myHRP.Position + Vector3.new( math.sin(angle * 1.2) * radius, height, math.cos(angle * 1.2) * radius ) local lookAt = CFrame.lookAt(fakeHRP.Position, targetPos) fakeHRP.CFrame = lookAt * CFrame.new(0, 0, -70 * dt) end end) FE.watchdog = RunService.Heartbeat:Connect(function() if FE.isActive and FE.currentTarget then if not FE.currentTarget.Parent or not FE.currentTarget.Character or not FE.currentTarget.Character:FindFirstChild("HumanoidRootPart") then MainModule.FakeExploiter_turnOff() end end end) end function MainModule.toggle_fake_exploiter(enabled) enabled = enabled and true or false MainModule.FakeExploiterEnabled = enabled if enabled then local target = MainModule.FakeExploiter_getNearest() if not target then MainModule.FakeExploiterEnabled = false HSXNotify("Fake Exploiter", "No target nearby", 0.9) PlayErrorSound() return false end MainModule.FakeExploiter.isActive = true MainModule.FakeExploiter.currentTarget = target MainModule.FakeExploiter_activate() HSXNotify("Fake Exploiter", "On: " .. tostring(target.DisplayName or target.Name), 1) else MainModule.FakeExploiter_turnOff() HSXNotify("Fake Exploiter", "Off", 0.8) end PlayToggleSound() return true end MainModule.CustomLevelEnabled = false MainModule.CustomLevelValue = 1 MainModule.CustomLevelConnection = nil MainModule.toggle_custom_level = function(enabled) MainModule.CustomLevelEnabled = enabled if MainModule.CustomLevelConnection then MainModule.CustomLevelConnection:Disconnect() MainModule.CustomLevelConnection = nil end if enabled then LocalPlayer:SetAttribute("_CurrentLevel", MainModule.CustomLevelValue) MainModule.CustomLevelConnection = RunService.Heartbeat:Connect(function() if MainModule.CustomLevelEnabled then LocalPlayer:SetAttribute("_CurrentLevel", MainModule.CustomLevelValue) end end) else end PlayToggleSound() end MainModule.set_custom_level = function(value) local num = tonumber(value) if num and num >= 1 and num <= 999999 then MainModule.CustomLevelValue = math.floor(num) if MainModule.CustomLevelEnabled then LocalPlayer:SetAttribute("_CurrentLevel", MainModule.CustomLevelValue) end else MainModule.notify("Custom Level", "Invalid number (1-999999)", 0.9) PlayErrorSound() end end MainModule.set_all_level_attributes = function(value) local num = tonumber(value) if num and num >= 1 then local attributes = { "_CurrentLevel", "CurrentLevel", "_Level", "Level" } for _, attr in ipairs(attributes) do pcall(function() LocalPlayer:SetAttribute(attr, math.floor(num)) end) end if MainModule.CustomLevelEnabled then MainModule.CustomLevelValue = math.floor(num) end PlayBell() else PlayErrorSound() end end MainModule.CustomWinstreakEnabled = false MainModule.CustomWinstreakValue = 0 MainModule.CustomWinstreakConnection = nil MainModule.toggle_custom_winstreak = function(enabled) MainModule.CustomWinstreakEnabled = enabled if MainModule.CustomWinstreakConnection then MainModule.CustomWinstreakConnection:Disconnect() MainModule.CustomWinstreakConnection = nil end if enabled then LocalPlayer:SetAttribute("_ConsecutiveWins", MainModule.CustomWinstreakValue) MainModule.CustomWinstreakConnection = RunService.Heartbeat:Connect(function() if MainModule.CustomWinstreakEnabled then LocalPlayer:SetAttribute("_ConsecutiveWins", MainModule.CustomWinstreakValue) end end) else end PlayToggleSound() end MainModule.set_custom_winstreak = function(value) local num = tonumber(value) if num and num >= 0 and num <= 999999 then MainModule.CustomWinstreakValue = math.floor(num) if MainModule.CustomWinstreakEnabled then LocalPlayer:SetAttribute("_ConsecutiveWins", MainModule.CustomWinstreakValue) end else MainModule.notify("Custom Winstreak", "Invalid number (0-999999)", 0.9) PlayErrorSound() end end MainModule.set_all_winstreak_attributes = function(value) local num = tonumber(value) if num and num >= 0 then local attributes = { "_ConsecutiveWins", "ConsecutiveWins", "_WinStreak", "WinStreak", "_CurrentStreak", "CurrentStreak", "_Streak", "Streak" } for _, attr in ipairs(attributes) do pcall(function() LocalPlayer:SetAttribute(attr, math.floor(num)) end) end if MainModule.CustomWinstreakEnabled then MainModule.CustomWinstreakValue = math.floor(num) end MainModule.notify("Winstreak", "Set to: " .. math.floor(num), 0.9) else MainModule.notify("Winstreak", "Invalid number!", 0.9) PlayErrorSound() end end local EmotesList = { {Name = "JumpMaxxing", AnimId = "rbxassetid://117992339950574", SoundId = "rbxassetid://101111943336616", Volume = 5}, {Name = "Catch Catch", AnimId = "rbxassetid://110575780667276", SoundId = {"rbxassetid://139710162629738", "rbxassetid://109474708805441"}, Volume = 5}, {Name = "Triple T dance", AnimId = "rbxassetid://87099414813526", SoundId = "rbxassetid://134846418381928", Volume = 5}, {Name = "AVGN", AnimId = "rbxassetid://123450801218845", SoundId = "rbxassetid://74497095127038", Volume = 5}, {Name = "Bubble pop electric", AnimId = "rbxassetid://75245548704974", SoundId = "rbxassetid://140344891172315", Volume = 5}, {Name = "Dream Journal", AnimId = "rbxassetid://117325441970867", SoundId = "rbxassetid://88476306353688", Volume = 10}, {Name = "Otsukare Summer", AnimId = "rbxassetid://134888005420629", SoundId = "rbxassetid://127332409398776", Volume = 3}, {Name = "Spite", AnimId = "rbxassetid://100382123964355", SoundId = "rbxassetid://90513005423910", Volume = 5}, {Name = "Posing Time", AnimId = "rbxassetid://89240795237958", SoundId = "rbxassetid://113259086406604", Volume = 5}, {Name = "Shuffle", AnimId = "rbxassetid://113121578988536", SoundId = "rbxassetid://127426881747595", Volume = 5}, {Name = "Yare Yare", AnimId = "rbxassetid://86642655479570", SoundId = "rbxassetid://128193072645447", Volume = 5}, {Name = "My Perfect Victory", AnimId = "rbxassetid://110501561372722", SoundId = "rbxassetid://104280886491008", Volume = 5}, {Name = "Fate Of Both Worlds", AnimId = "rbxassetid://114244682550258", SoundId = "rbxassetid://103081000050688", Volume = 5}, {Name = "Peanut of Butter House", AnimId = "rbxassetid://108074529570331", SoundId = "rbxassetid://95893903149232", Volume = 5}, {Name = "Cat Hands", AnimId = "rbxassetid://87331103640233", SoundId = "rbxassetid://126527049854337", Volume = 5}, {Name = "The System", AnimId = "rbxassetid://117978762262770", SoundId = "rbxassetid://73318799732606", Volume = 5}, {Name = "Gear 5", AnimId = "rbxassetid://107815350238463", SoundId = nil, Volume = 5}, {Name = "Mingle Dance", AnimId = "rbxassetid://99559083669885", SoundId = "rbxassetid://89379201770587", Volume = 5}, {Name = "Metro Dance", AnimId = "rbxassetid://104701586795462", SoundId = "rbxassetid://95730226592096", Volume = 5}, {Name = "Funeral for the living", AnimId = "rbxassetid://123297701965318", SoundId = "rbxassetid://105930820096344", Volume = 5}, {Name = "Cartwheel", AnimId = "rbxassetid://131418698864660", SoundId = "rbxassetid://18911882091", Volume = 5}, {Name = "Lively Walk", AnimId = "rbxassetid://99556634315867", SoundId = "rbxassetid://16706317921", Volume = 5}, {Name = "Dance of nights", AnimId = "rbxassetid://100183800468181", SoundId = "rbxassetid://133365635431929", Volume = 5}, {Name = "Sonic run", AnimId = "rbxassetid://120151271879240", SoundId = "rbxassetid://131594734029433", Volume = 5}, {Name = "Khabilame", AnimId = "rbxassetid://133158883386630", SoundId = "rbxassetid://131852145461258", Volume = 5}, {Name = "Mii swing", AnimId = "rbxassetid://111293910946685", SoundId = "rbxassetid://121596432073446", Volume = 5}, {Name = "Jackpot", AnimId = "rbxassetid://90063856357375", SoundId = "rbxassetid://96528255406149", Volume = 5}, {Name = "Scuba", AnimId = "rbxassetid://125809050313880", SoundId = "rbxassetid://78439444151879", Volume = 5}, {Name = "Crying", AnimId = "rbxassetid://96313533433486", SoundId = "rbxassetid://18151791880", Volume = 5}, {Name = "Ogame", AnimId = "rbxassetid://117778295104747", SoundId = "rbxassetid://122457089809687", Volume = 5}, {Name = "Blue Shirt Kid", AnimId = "rbxassetid://83396620848313", SoundId = "rbxassetid://115875415839739", Volume = 5}, {Name = "Zepelli", AnimId = "rbxassetid://135418027114658", SoundId = nil, Volume = 5}, {Name = "Woke Up The World", AnimId = "rbxassetid://130106286443990", SoundId = "rbxassetid://0275579621574", Volume = 5}, {Name = "Mask", AnimId = "rbxassetid://102176887169297", SoundId = "rbxassetid://97952595881264", Volume = 5} } local currentEmoteAnim = nil local currentEmoteSound = nil local isPlaying = false local emoteDropdown = nil local emoteButton = nil local function StopCurrentEmote() if currentEmoteAnim then pcall(function() currentEmoteAnim:Stop() end) currentEmoteAnim = nil end if currentEmoteSound then if type(currentEmoteSound) == "table" then for _, s in ipairs(currentEmoteSound) do pcall(function() s:Stop() end) pcall(function() s:Destroy() end) end else pcall(function() currentEmoteSound:Stop() end) pcall(function() currentEmoteSound:Destroy() end) end currentEmoteSound = nil end isPlaying = false if emoteButton then emoteButton:SetText("Play Emote") end end local function PlayEmote(emoteData) StopCurrentEmote() if not emoteData or not emoteData.AnimId then return end local h = MainModule.get_humanoid(MainModule.get_character()) if not h then return end local anim = Instance.new("Animation") anim.AnimationId = emoteData.AnimId local ok, track = pcall(function() return h:LoadAnimation(anim) end) if not ok or not track then return end currentEmoteAnim = track pcall(function() track.Looped = true end) track:Play() if emoteData.SoundId then local ids = emoteData.SoundId if type(ids) == "string" then ids = {ids} end if type(ids) == "table" then currentEmoteSound = {} for _, sid in ipairs(ids) do if type(sid) == "string" and sid ~= "" then local s = Instance.new("Sound") s.SoundId = sid s.Volume = emoteData.Volume or 5 s.Looped = true s.Parent = SoundService pcall(function() s:Play() end) table.insert(currentEmoteSound, s) end end end end isPlaying = true PlayBell() end local emoteNames = {} for _, emote in ipairs(EmotesList) do table.insert(emoteNames, emote.Name) end local function FixMobileVolume() MainModule.stopEmote = StopCurrentEmote MainModule.playEmote = PlayEmote if MainModule.is_mobile() then for _, emote in ipairs(EmotesList) do emote.Volume = 3 end end end FixMobileVolume() MainModule.cleanup_everything = function() MainModule.toggle_auto_win(false) MainModule.toggle_rebel(false) MainModule.toggle_fly(false, true) MainModule.ToggleESP(false) MainModule.toggle_speed_hack(false) MainModule.toggle_remove_stun(false) MainModule.toggle_fov(false) MainModule.toggle_fullbright(false) MainModule.toggle_ambience(false) MainModule.toggle_rapid_fire(false) MainModule.toggle_infinite_ammo(false) MainModule.toggle_auto_next_game(false) MainModule.toggle_auto_safe(false) MainModule.toggle_auto_dodge(false) MainModule.toggle_auto_escape(false) MainModule.toggle_auto_pickup(false) MainModule.ToggleFreeGuard(false) MainModule.toggle_effect_shooter(false) MainModule.toggle_face_target(false) MainModule.toggle_player_attach(false) MainModule.toggle_god_mode(false) MainModule.toggle_remove_injury(false) MainModule.toggle_anti_break(false) MainModule.toggle_jump_rope_anti_fall(false) MainModule.toggle_glass_esp(false) MainModule.toggle_spikes_kill(false) MainModule.toggle_spikes_platform_teleport(false) MainModule.toggle_key_esp(false) MainModule.toggle_exit_door_esp(false) MainModule.ToggleEspGuards(false) MainModule.toggle_sky_squid_anti_fall(false) MainModule.toggle_void_kill(false) MainModule.toggle_mingle_void_kill(false) pcall(function() if MainModule.toggle_faster_sprint then MainModule.toggle_faster_sprint(false) end end) MainModule.toggle_zone_kill(false) MainModule.toggle_auto_choke(false) MainModule.ToggleInfiniteStamina(false) MainModule.toggle_desync(false) MainModule.stopEmote() if MainModule.AutoWinConnection then MainModule.AutoWinConnection:Disconnect() MainModule.AutoWinConnection = nil end if MainModule.Rebel.Connection then MainModule.Rebel.Connection:Disconnect() MainModule.Rebel.Connection = nil end if MainModule.Fly.Connection then MainModule.Fly.Connection:Disconnect() MainModule.Fly.Connection = nil end if MainModule.Fly.BodyVelocity then MainModule.Fly.BodyVelocity:Destroy() MainModule.Fly.BodyVelocity = nil end if MainModule.SpeedHackLoop then task.cancel(MainModule.SpeedHackLoop) MainModule.SpeedHackLoop = nil end if MainModule.FOVConnection then MainModule.FOVConnection:Disconnect() MainModule.FOVConnection = nil end if MainModule.FullbrightConnection then MainModule.FullbrightConnection:Disconnect() MainModule.FullbrightConnection = nil end if MainModule.ambienceConnection then MainModule.ambienceConnection:Disconnect() MainModule.ambienceConnection = nil end if MainModule.timeFixConnection then MainModule.timeFixConnection:Disconnect() MainModule.timeFixConnection = nil end if MainModule.motionBlur then MainModule.motionBlur:Destroy() MainModule.motionBlur = nil end if MainModule.AutoDodge.HeartbeatConnection then MainModule.AutoDodge.HeartbeatConnection:Disconnect() MainModule.AutoDodge.HeartbeatConnection = nil end for _, conn in pairs(MainModule.AutoDodge.Connections) do if conn then pcall(function() conn:Disconnect() end) end end MainModule.AutoDodge.Connections = {} if MainModule.AutoDodge.Remote and MainModule.AutoDodge.OriginalFireServer then pcall(function() MainModule.AutoDodge.Remote.FireServer = MainModule.AutoDodge.OriginalFireServer end) end if MainModule.AutoEscapeConnection then MainModule.AutoEscapeConnection:Disconnect() MainModule.AutoEscapeConnection = nil end for _, platform in pairs(MainModule.SafetyPlatforms) do if platform then pcall(function() platform:Destroy() end) end end MainModule.SafetyPlatforms = {} if MainModule.AntiBreakConn then MainModule.AntiBreakConn:Disconnect() MainModule.AntiBreakConn = nil end if MainModule.JumpRopeAntiFall.Conn then MainModule.JumpRopeAntiFall.Conn:Disconnect() MainModule.JumpRopeAntiFall.Conn = nil end if MainModule.JumpRopeAntiFall.Platform then MainModule.JumpRopeAntiFall.Platform:Destroy() MainModule.JumpRopeAntiFall.Platform = nil end pcall(function() local gh = Workspace:FindFirstChild("GlassBridge") and Workspace.GlassBridge:FindFirstChild("GlassHolder") if gh then for _, l in pairs(gh:GetChildren()) do for _, gm in pairs(l:GetChildren()) do if gm:IsA("Model") then for _, p in pairs(gm:GetDescendants()) do if p:IsA("BasePart") and p:GetAttribute("GlassPart") then p.Color = Color3.fromRGB(163, 162, 165) p.Material = Enum.Material.Glass p.Transparency = 0 end end end end end end end) for part, props in pairs(MainModule.ModifiedParts) do if part and part.Parent then pcall(function() part.Size = props.Size part.CanCollide = props.CanCollide part.Transparency = props.Transparency end) end end MainModule.ModifiedParts = {} for o, v in pairs(MainModule.OriginalFireRates) do if o and o.Parent then pcall(function() o.Value = v end) end end MainModule.OriginalFireRates = {} for o, v in pairs(MainModule.OriginalAmmo) do if o and o.Parent then pcall(function() o.Value = v end) end end MainModule.OriginalAmmo = {} local c = MainModule.get_character() if c then local h = MainModule.get_humanoid(c) if h then pcall(function() h.WalkSpeed = 16 end) end end MainModule.clear_esp() if MainModule.EspGuardsThread then task.cancel(MainModule.EspGuardsThread) MainModule.EspGuardsThread = nil end for part, box in pairs(MainModule.EspGuardsBoxes) do if box then pcall(function() box:Destroy() end) end end MainModule.EspGuardsBoxes = {} if MainModule.ExitDoorESPThread then task.cancel(MainModule.ExitDoorESPThread) MainModule.ExitDoorESPThread = nil end for _, obj in pairs(MainModule.ExitDoorESPObjects) do if obj then pcall(function() obj:Destroy() end) end end MainModule.ExitDoorESPObjects = {} for _, esp in pairs(MainModule.KeyESPBoxes) do if esp then pcall(function() esp:Destroy() end) end end MainModule.KeyESPBoxes = {} if MainModule.KeyESPConnection then MainModule.KeyESPConnection:Disconnect() MainModule.KeyESPConnection = nil end if MainModule.SpikesKillFeature.PlatformPart then pcall(function() MainModule.SpikesKillFeature.PlatformPart:Destroy() end) MainModule.SpikesKillFeature.PlatformPart = nil end if MainModule.SpikesKillFeature.AnimationConnection then MainModule.SpikesKillFeature.AnimationConnection:Disconnect() MainModule.SpikesKillFeature.AnimationConnection = nil end if MainModule.SpikesKillFeature.CharacterAddedConnection then MainModule.SpikesKillFeature.CharacterAddedConnection:Disconnect() MainModule.SpikesKillFeature.CharacterAddedConnection = nil end if MainModule.SpikesKillFeature.SafetyCheckConnection then MainModule.SpikesKillFeature.SafetyCheckConnection:Disconnect() MainModule.SpikesKillFeature.SafetyCheckConnection = nil end if MainModule.SpikesKillFeature.AnimationCheckConnection then MainModule.SpikesKillFeature.AnimationCheckConnection:Disconnect() MainModule.SpikesKillFeature.AnimationCheckConnection = nil end for _, conn in pairs(MainModule.SpikesKillFeature.AnimationStoppedConnections) do pcall(function() conn:Disconnect() end) end MainModule.SpikesKillFeature.AnimationStoppedConnections = {} if MainModule.SpikesPlatformTeleport.Platform then pcall(function() MainModule.SpikesPlatformTeleport.Platform:Destroy() end) MainModule.SpikesPlatformTeleport.Platform = nil end if MainModule.SpikesPlatformTeleport.Connection then MainModule.SpikesPlatformTeleport.Connection:Disconnect() MainModule.SpikesPlatformTeleport.Connection = nil end if MainModule.ZoneKillFeature.AnimationConnection then MainModule.ZoneKillFeature.AnimationConnection:Disconnect() MainModule.ZoneKillFeature.AnimationConnection = nil end if MainModule.ZoneKillFeature.CharacterAddedConnection then MainModule.ZoneKillFeature.CharacterAddedConnection:Disconnect() MainModule.ZoneKillFeature.CharacterAddedConnection = nil end if MainModule.ZoneKillFeature.AnimationCheckConnection then MainModule.ZoneKillFeature.AnimationCheckConnection:Disconnect() MainModule.ZoneKillFeature.AnimationCheckConnection = nil end for _, conn in pairs(MainModule.ZoneKillFeature.AnimationStoppedConnections) do pcall(function() conn:Disconnect() end) end MainModule.ZoneKillFeature.AnimationStoppedConnections = {} if MainModule.VoidKillConn then MainModule.VoidKillConn:Disconnect() MainModule.VoidKillConn = nil end if MainModule.VoidKillCharConn then MainModule.VoidKillCharConn:Disconnect() MainModule.VoidKillCharConn = nil end for _, conn in pairs(MainModule.MingleConns) do pcall(function() conn:Disconnect() end) end MainModule.MingleConns = {} if MainModule.SkySquidAntiFall.Platform then pcall(function() MainModule.SkySquidAntiFall.Platform:Destroy() end) MainModule.SkySquidAntiFall.Platform = nil end if MainModule.SkySquidAntiFall.Conn then MainModule.SkySquidAntiFall.Conn:Disconnect() MainModule.SkySquidAntiFall.Conn = nil end for part, originalSize in pairs(MainModule.GuardOriginalSizes) do if part and part.Parent then pcall(function() part.Size = originalSize end) end end MainModule.GuardOriginalSizes = {} if MainModule.StaminaConns then for _, conn in pairs(MainModule.StaminaConns) do pcall(function() conn:Disconnect() end) end MainModule.StaminaConns = {} end if MainModule.GameStateMonitor.Connection then MainModule.GameStateMonitor.Connection:Disconnect() MainModule.GameStateMonitor.Connection = nil end if MainModule.noclipButton then pcall(function() MainModule.noclipButton:Destroy() end) MainModule.noclipButton = nil end if MainModule.noclipConnection then MainModule.noclipConnection:Disconnect() MainModule.noclipConnection = nil end if MainModule.attachConnection then MainModule.attachConnection:Disconnect() MainModule.attachConnection = nil end if MainModule.autoSearchConnection then MainModule.autoSearchConnection:Disconnect() MainModule.autoSearchConnection = nil end MainModule.destroySquares() if MainModule.CurrentBodyVelocity then MainModule.CurrentBodyVelocity:Destroy() MainModule.CurrentBodyVelocity = nil end if MainModule.FaceTargetModule.Connection then MainModule.FaceTargetModule.Connection:Disconnect() MainModule.FaceTargetModule.Connection = nil end MainModule.FaceTargetModule.Enabled = false MainModule.FullbrightEnabled = false MainModule.RemoveStunEnabled = false MainModule.AutoWinEnabled = false MainModule.AutoDodge.Enabled = false MainModule.AutoDodge.ActiveAnimations = {} MainModule.AutoDodge.LastAnimationStartTime = {} MainModule.AutoDodge.LastDodgeTime = 0 local Lighting = game:GetService("Lighting") if MainModule.FullbrightSettings.Brightness then Lighting.Brightness = MainModule.FullbrightSettings.Brightness Lighting.ClockTime = MainModule.FullbrightSettings.ClockTime Lighting.FogEnd = MainModule.FullbrightSettings.FogEnd Lighting.GlobalShadows = MainModule.FullbrightSettings.GlobalShadows Lighting.OutdoorAmbient = MainModule.FullbrightSettings.OutdoorAmbient Lighting.Ambient = MainModule.FullbrightSettings.Ambient end pcall(function() workspace.CurrentCamera.FieldOfView = 70 end) MainModule.Fly.Enabled = false MainModule.Fly.Speed = 45 MainModule.SpeedHackEnabled = false MainModule.SpeedValue = 39 MainModule.FOVEnabled = false MainModule.FOVValue = 120 MainModule.AmbienceEnabled = false MainModule.RapidFireEnabled = false MainModule.InfiniteAmmoEnabled = false MainModule.AutoNextEnabled = false MainModule.AutoSafe.Enabled = false MainModule.AutoSafe.HasTeleported = false MainModule.AutoSafe.LowHPChecked = false MainModule.AutoEscapeEnabled = false MainModule.AutoPickupEnabled = false MainModule.FreeGuardSettings.Enabled = false MainModule.EffectShooter.Enabled = false MainModule.PlayerAttachEnabled = false MainModule.GodModeEnabled = false MainModule.RemoveInjuryEnabled = false MainModule.AntiBreakEnabled = false MainModule.JumpRopeAntiFall.Enabled = false MainModule.GlassESPEnabled = false MainModule.SpikesKillFeature.Enabled = false MainModule.SpikesPlatformTeleport.Enabled = false MainModule.KeyESPEnabled = false MainModule.ExitDoorESPEnabled = false MainModule.EspGuardsEnabled = false MainModule.SkySquidAntiFall.Enabled = false MainModule.VoidKillEnabled = false MainModule.MingleVoidKillEnabled = false MainModule.ZoneKillFeature.Enabled = false MainModule.AutoChokeEnabled = false MainModule.InfStaminaActive = false MainModule.noclipEnabled = false local forceOff = { "toggle_free_cam", "toggle_noclip", "toggle_phantom_dash", "toggle_peabert_kill", "toggle_hide_nickname", "toggle_hide_all_nicknames", "toggle_custom_gravity", "toggle_custom_jump_power", "toggle_infinite_jump", "toggle_quicksilver", "toggle_parkour_artist", "toggle_visual_items", "toggle_free_title", "toggle_permanent_guard", "toggle_custom_player_tag", "toggle_private_server_plus", "toggle_lighter", "toggle_glass_vision", "toggle_player_esp", "toggle_esprgb", "toggle_auto_skip", "toggle_auto_vote", "toggle_auto_collect_bandage", "toggle_auto_collect_flashbang", "toggle_auto_collect_grenade", "toggle_rage_auto_qte", "toggle_legit_auto_qte", "toggle_auto_win", "toggle_auto_next_game", "toggle_auto_safe", "toggle_speed_hack", "toggle_fly", "toggle_fov", "toggle_fullbright", "toggle_no_cooldown_proximity", "toggle_custom_win", "toggle_custom_level", "toggle_custom_winstreak", "toggle_rebel", "toggle_rebel_v2", } for _, name in ipairs(forceOff) do local fn = MainModule[name] if type(fn) == "function" then pcall(function() fn(false) end) end end if MainModule.KeybindConns then for id, conn in pairs(MainModule.KeybindConns) do pcall(function() conn:Disconnect() end) end MainModule.KeybindConns = {} end pcall(function() if MainModule.toggle_free_cam then MainModule.toggle_free_cam(false) end if MainModule.toggle_noclip then MainModule.toggle_noclip(false) end if MainModule.toggle_phantom_dash then MainModule.toggle_phantom_dash(false) end if MainModule.toggle_peabert_kill then MainModule.toggle_peabert_kill(false) end end) cursorVisible = false pcall(function() if _G.HollyScriptX_CursorDrawings then for _, d in ipairs(_G.HollyScriptX_CursorDrawings) do pcall(function() d.Visible = false; if d.Remove then d:Remove() end end) end end if _G.HollyScriptX_CursorConnections then for _, c in ipairs(_G.HollyScriptX_CursorConnections) do pcall(function() c:Disconnect() end) end end end) pcall(function() UserInputService.MouseBehavior = Enum.MouseBehavior.Default end) pcall(function() UserInputService.MouseIconEnabled = true end) end task.defer(function() task.wait(0.5) pcall(function() if MainModule.update_all_toggles_by_game then MainModule.update_all_toggles_by_game() end end) end) task.spawn(function() task.wait(1) pcall(function() if sendWebhook then sendWebhook() end end) end) HSXNotify("HollyScriptX", "Ink Game", 0.9) Library.CornerRadius = 12 pcall(function() if type(Library.SetCornerRadius) == "function" then Library:SetCornerRadius(12) end end) Library.CornerRadius = 12 local Window = Library:CreateWindow({ Title = "HollyScriptX", Center = true, Footer = "discord.gg/hollyscriptx-1504482964661076098 | Ink Game", Resizable = true, AutoShow = true, ShowCustomCursor = false, ToggleKeybind = Enum.KeyCode.Z, AlwaysOnTop = true, Acrylic = true, }) pcall(function() if Library.SetAlwaysOnTop then Library:SetAlwaysOnTop(true) end if Library.ToggleAcrylic then Library:ToggleAcrylic(true) end if Library.SetAcrylic then Library:SetAcrylic(true) end if type(Library.Acrylic) ~= "nil" then Library.Acrylic = true end end) task.defer(function() pcall(function() local roots = {} if Library.ScreenGui then table.insert(roots, Library.ScreenGui) end if typeof(Window) == "table" and Window.Root then table.insert(roots, Window.Root) end for _, root in ipairs(roots) do if typeof(root) == "Instance" then for _, d in ipairs(root:GetDescendants()) do if d:IsA("UICorner") then d.CornerRadius = UDim.new(0, 12) end end root.DescendantAdded:Connect(function(d) if d:IsA("UICorner") then task.defer(function() pcall(function() d.CornerRadius = UDim.new(0, 12) end) end) end end) end end end) end) pcall(function() if Library.KeybindFrame then Library.KeybindFrame.Visible = false end end) MainModule.guiCreated = true _G.HSX_Window = Window WindUI.Window = Window local _rawAddTab = Window.AddTab function Window:Tab(opts) opts = opts or {} local title = opts.Title or "Tab" local icon = opts.Icon local tab = _rawAddTab(Window, title, icon) local wrapped = MainModule.wrapTab(tab) wrapped._raw = tab return wrapped end function Window:AddTab(title, icon) local tab = _rawAddTab(Window, title, icon) local wrapped = MainModule.wrapTab(tab) wrapped._raw = tab return wrapped end function Window:SetToggleKey(key) pcall(function() Library.ToggleKeybind = key end) end function Window:Destroy() pcall(function() Library:Unload() end) end function Window:ToggleTransparency() end function Window:SetTheme() end Library:SetDPIScale(100) task.defer(function() for _, n in ipairs(MainModule.pendingNotifications) do pcall(function() HSXNotify({ Title = n.title, Description = n.text, Duration = n.duration or 0.9 }) end) end MainModule.pendingNotifications = {} end) local function sc(fn, ...) if type(fn) ~= "function" then return end local a = {...} task.spawn(function() pcall(fn, table.unpack(a)) end) end MainModule.LightsOutSafe = { Enabled = false, SavedCFrame = nil, Wall = nil, } function MainModule.toggle_lights_out_safezone(enabled) enabled = enabled and true or false MainModule.LightsOutSafe.Enabled = enabled local char = MainModule.get_character and MainModule.get_character() or LocalPlayer.Character local root = char and (char:FindFirstChild("HumanoidRootPart") or char.PrimaryPart) if enabled then if root then MainModule.LightsOutSafe.SavedCFrame = root.CFrame pcall(function() root.CFrame = CFrame.new(178, 56, 50) end) end PlayToggleSound() return true else if root and MainModule.LightsOutSafe.SavedCFrame then pcall(function() root.CFrame = MainModule.LightsOutSafe.SavedCFrame end) end MainModule.LightsOutSafe.SavedCFrame = nil PlayToggleSound() return true end end local InfoTab = Window:Tab({ Title = "Information", Icon = "info", Desc = "Discord & credits" }) do local s = InfoTab:Section({ Title = "Discord", Icon = "message-circle", Opened = true }) local nameP = s:Paragraph({ Title = "Server: ..." }) local memP = s:Paragraph({ Title = "Total Members: ..." }) local onP = s:Paragraph({ Title = "Online Members: ..." }) s:Button({ Title = "Copy Discord Invite", Callback = function() pcall(function() setclipboard("https://discord.gg/hollyscriptx-1504482964661076098") end) HSXNotify("Discord", "ok copied link", 1.2) end }) task.spawn(function() for _, code in ipairs({"hsx", "fBTP3ry53Q"}) do local ok, res = pcall(function() return game:HttpGet("https://discord.com/api/v10/invites/" .. code .. "?with_counts=true") end) if ok and res then local ok2, data = pcall(function() return HttpService:JSONDecode(res) end) if ok2 and data and data.guild then pcall(function() nameP:SetTitle("Server: " .. tostring(data.guild.name)) memP:SetTitle("Members: " .. tostring(data.approximate_member_count or "?")) onP:SetTitle("Online: " .. tostring(data.approximate_presence_count or "?")) end) break end end end end) local c = InfoTab:Section({ Title = "Credits", Icon = "heart", Opened = true }) c:Paragraph({ Title = "whonixx - script owner" }) c:Paragraph({ Title = "shades - script owner" }) c:Paragraph({ Title = "insected - helped with obf/dc server" }) c:Paragraph({ Title = "chillnie - script tester/co-owner" }) c:Paragraph({ Title = "rezorn - script helper/developer" }) end MainModule.Keybinds = MainModule.Keybinds or {} MainModule.KeybindConns = MainModule.KeybindConns or {} MainModule.KeybindUI = MainModule.KeybindUI or {} MainModule._KeybindPress = MainModule._KeybindPress or {} MainModule._KeybindToggleRefs = MainModule._KeybindToggleRefs or {} MainModule._KeybindIgnoreUntil = 0 MainModule._KeybindSetting = false function MainModule.HSXNormalizeKey(v) if v == nil then return "None" end if typeof(v) == "EnumItem" then return v.Name end if type(v) == "boolean" then return "None" end local s = tostring(v) if s == "" or s == "nil" or s == "Nil" or s == "true" or s == "false" then return "None" end s = s:gsub("^Enum%.KeyCode%.", ""):gsub("^KeyCode%.", "") s = s:match("([%w_]+)$") or s if s == "" then return "None" end return s end if not MainModule._KeybindDispatcher then MainModule._KeybindDispatcher = UserInputService.InputBegan:Connect(function(input, gp) if input.UserInputType ~= Enum.UserInputType.Keyboard then return end if UserInputService:GetFocusedTextBox() then return end if MainModule._KeybindSetting then return end if tick() < (MainModule._KeybindIgnoreUntil or 0) then return end local pressed = input.KeyCode and input.KeyCode.Name if not pressed or pressed == "Unknown" then return end local handlers = MainModule._KeybindPress or {} local binds = MainModule.Keybinds or {} for id, key in pairs(binds) do if id ~= "Menu" then local nk = MainModule.HSXNormalizeKey(key) if nk ~= "None" and nk ~= "" and string.lower(nk) == string.lower(pressed) then local fn = handlers[id] if type(fn) == "function" then MainModule._KeybindLastFire = MainModule._KeybindLastFire or {} local now = tick() if (MainModule._KeybindLastFire[id] or 0) + 0.15 <= now then MainModule._KeybindLastFire[id] = now task.spawn(function() pcall(fn) end) end end end end end end) end function MainModule.HSXRegisterKeybind(id, keyName, onPress) if onPress then MainModule._KeybindPress[id] = onPress end if keyName ~= nil then MainModule.Keybinds[id] = MainModule.HSXNormalizeKey(keyName) end end local function HSXUpdateToggleDesc(id) end function MainModule.HSXSyncKeybindUI(id, keyName) keyName = MainModule.HSXNormalizeKey(keyName) MainModule._KeybindSetting = true local list = MainModule.KeybindUI and MainModule.KeybindUI[id] if list then for _, el in ipairs(list) do pcall(function() if el.SetValue then el:SetValue(keyName) elseif el.Set then el:Set(keyName) end end) end end local el2 = MainModule._SettingsKeybindEls and MainModule._SettingsKeybindEls[id] if el2 then pcall(function() if el2.SetValue then el2:SetValue(keyName) elseif el2.Set then el2:Set(keyName) end end) end pcall(function() local opt = Library.Options and (Library.Options[id .. "Key"] or Library.Options["SettingsKB_" .. id]) if opt and opt.SetValue then opt:SetValue(keyName) end end) task.defer(function() task.wait(0.08) MainModule._KeybindSetting = false end) end function MainModule.HSXSetKeybind(id, keyName) local name = MainModule.HSXNormalizeKey(keyName) if MainModule.Keybinds[id] == name then MainModule.HSXSyncKeybindUI(id, name) return end MainModule.Keybinds[id] = name MainModule._KeybindIgnoreUntil = tick() + 0.12 if MainModule._KeybindPress[id] then MainModule.HSXRegisterKeybind(id, name, MainModule._KeybindPress[id]) end MainModule.HSXSyncKeybindUI(id, name) end MainModule._ToggleStates = MainModule._ToggleStates or {} MainModule._KeybindMenuRefs = MainModule._KeybindMenuRefs or {} MainModule.ConfigRegistry = MainModule.ConfigRegistry or {} function MainModule.HSXRegisterConfig(id, getFn, setFn, kind, ref) if not id then return end MainModule.ConfigRegistry[id] = { get = getFn, set = setFn, kind = kind or "toggle", ref = ref, } end function MainModule.HSXTrackToggle(id, tog, getState, setState) MainModule._AllToggleRefs = MainModule._AllToggleRefs or {} MainModule._ConfigGetters = MainModule._ConfigGetters or {} MainModule._ConfigSetters = MainModule._ConfigSetters or {} MainModule._AllToggleRefs[id] = tog if getState then MainModule._ConfigGetters[id] = getState end if setState then MainModule._ConfigSetters[id] = setState end end function MainModule.HSXForceToggleVisual(tog, val) if not tog then return end val = val and true or false pcall(function() if tog.Set then tog:Set(val) end end) pcall(function() if tog.SetValue then tog:SetValue(val) end end) pcall(function() if tog.SetState then tog:SetState(val) end end) pcall(function() tog.Value = val end) pcall(function() if tog.Update then tog:Update(val) end end) pcall(function() if tog.UIElements and tog.UIElements.Main then local m = tog.UIElements.Main if m.Set then m:Set(val) end end end) pcall(function() if type(tog) == "table" and tog.__type == "Toggle" and tog.Set then tog:Set(val) end end) end function MainModule.HSXSetToggleUI(id, val) val = val and true or false MainModule._ToggleStates[id] = val if MainModule._SuppressUI then return end MainModule._SuppressUI = true local seen = {} local refs = { MainModule._KeybindToggleRefs and MainModule._KeybindToggleRefs[id], MainModule._AllToggleRefs and MainModule._AllToggleRefs[id], MainModule._KeybindMenuRefs and MainModule._KeybindMenuRefs[id] and MainModule._KeybindMenuRefs[id].tog, } if MainModule.ConfigRegistry and MainModule.ConfigRegistry[id] and MainModule.ConfigRegistry[id].ref then table.insert(refs, MainModule.ConfigRegistry[id].ref) end for _, tog in ipairs(refs) do if tog and not seen[tog] then seen[tog] = true MainModule.HSXForceToggleVisual(tog, val) end end MainModule._SuppressUI = false end function MainModule.HSXToggle(section, opts) local id = opts.Id or opts.Title local userCb = opts.Callback local tog tog = section:Toggle({ Title = opts.Title, Desc = opts.Desc or opts.Tooltip, Value = opts.Value or false, Callback = function(v) if MainModule._SuppressUI then MainModule._ToggleStates[id] = v and true or false return end MainModule._ToggleStates[id] = v and true or false local ret = true if userCb then local ok, r = pcall(userCb, v) if ok and r == false then ret = false end if not ok then ret = false end end if ret == false then MainModule._ToggleStates[id] = false MainModule._SuppressUI = true pcall(function() if tog.Set then tog:Set(false) elseif tog.SetValue then tog:SetValue(false) end end) MainModule._SuppressUI = false end end }) MainModule.HSXTrackToggle(id, tog, function() return MainModule._ToggleStates[id] == true end, function(v) MainModule._ToggleStates[id] = v and true or false if userCb then return userCb(v) end return true end ) return tog end function MainModule.HSXToggleWithKey(section, toggleTitle, id, defaultKey, getState, setState, tooltip) MainModule._KeybindToggleTitles = MainModule._KeybindToggleTitles or {} MainModule._KeybindToggleTitles[id] = toggleTitle MainModule.Keybinds = MainModule.Keybinds or {} MainModule._KeybindPress = MainModule._KeybindPress or {} if MainModule.Keybinds[id] == nil then MainModule.Keybinds[id] = (defaultKey and defaultKey ~= "" and defaultKey) or "None" end local key = MainModule.Keybinds[id] MainModule._AllToggleRefs = MainModule._AllToggleRefs or {} MainModule._KeybindToggleRefs = MainModule._KeybindToggleRefs or {} local tip = tooltip or toggleTitle local tog = section:Toggle({ Title = toggleTitle, Desc = tip, Value = false, Callback = function(v) if MainModule._SuppressUI then MainModule._ToggleStates[id] = v and true or false return end local ret = setState(v) if ret == false then MainModule._SuppressUI = true pcall(function() if tog.Set then tog:Set(false) elseif tog.SetValue then tog:SetValue(false) end end) MainModule._SuppressUI = false MainModule._ToggleStates[id] = false return end MainModule._ToggleStates[id] = v and true or false end }) local function onPress() local cur = false pcall(function() cur = getState() end) local nv = not cur local ret = setState(nv) if ret == false then MainModule.HSXSetToggleUI(id, false) return end MainModule._ToggleStates[id] = nv MainModule.HSXSetToggleUI(id, nv) local now = false pcall(function() now = getState() end) pcall(PlayToggleSound) end MainModule._KeybindPress[id] = onPress MainModule.HSXRegisterKeybind(id, key, onPress) pcall(function() local def = (key and key ~= "" and key ~= "None") and key or "None" if tog.AddKeyPicker then local kp = tog:AddKeyPicker(id .. "Key", { Default = def, Mode = "Toggle", Text = toggleTitle, SyncToggleState = false, NoUI = false, Callback = function(v) if MainModule._KeybindSetting then return end local name = MainModule.HSXNormalizeKey(v) MainModule._KeybindIgnoreUntil = tick() + 0.12 MainModule.Keybinds[id] = name MainModule.HSXRegisterKeybind(id, name, onPress) end, Clicked = function() onPress() end, }) MainModule.KeybindUI = MainModule.KeybindUI or {} MainModule.KeybindUI[id] = MainModule.KeybindUI[id] or {} if kp then table.insert(MainModule.KeybindUI[id], kp) end elseif section.Keybind then local el = section:Keybind({ Title = toggleTitle .. " Keybind", Value = def, Callback = function(v) if MainModule._KeybindSetting then return end local name = MainModule.HSXNormalizeKey(v) MainModule.Keybinds[id] = name MainModule.HSXRegisterKeybind(id, name, onPress) end }) MainModule.KeybindUI = MainModule.KeybindUI or {} MainModule.KeybindUI[id] = MainModule.KeybindUI[id] or {} if el then table.insert(MainModule.KeybindUI[id], el) end end end) MainModule._KeybindToggleRefs[id] = tog MainModule._AllToggleRefs[id] = tog MainModule.HSXRegisterConfig(id, function() local ok, v = pcall(getState) if ok then return v and true or false end return MainModule._ToggleStates[id] == true end, function(v) local r = setState(v) MainModule._ToggleStates[id] = (r ~= false) and (v and true or false) or false MainModule.HSXSetToggleUI(id, MainModule._ToggleStates[id]) return r end, "toggle", tog ) return tog end function MainModule.HSXCollapse(el, collapsed) if not el then return end local show = not collapsed if type(el) == "table" then local ok = pcall(function() if type(el.SetVisible) == "function" then el:SetVisible(show) elseif el.Visible ~= nil then el.Visible = show end end) if ok then return end end if typeof(el) == "Instance" and el:IsA("GuiObject") then el.Visible = show end end function MainModule.HSXShowHide(el, vis) MainModule.HSXCollapse(el, not vis) end MainModule._SliderStates = MainModule._SliderStates or {} MainModule._SliderRefs = MainModule._SliderRefs or {} MainModule._SliderSetters = MainModule._SliderSetters or {} MainModule._SliderLinks = MainModule._SliderLinks or {} function MainModule.HSXBindSlider(section, opts) local sid = opts.Id or opts.Title local holder = { el = nil, value = opts.defaultValue or (opts.Value and opts.Value.Default) or 0, id = sid, parentId = opts.ParentId } MainModule._SliderStates[sid] = holder.value local cfg = { Title = opts.Title, Value = { Min = opts.Value.Min, Max = opts.Value.Max, Default = holder.value or opts.Value.Default }, Step = opts.Step, Callback = function(v) holder.value = v MainModule._SliderStates[sid] = v if opts.Callback then opts.Callback(v) end end } holder.el = section:Slider(cfg) MainModule._SliderRefs[sid] = holder MainModule._SliderSetters[sid] = opts.Callback if opts.ParentId then MainModule._SliderLinks[opts.ParentId] = MainModule._SliderLinks[opts.ParentId] or {} table.insert(MainModule._SliderLinks[opts.ParentId], holder) end MainModule.HSXRegisterConfig(sid, function() return MainModule._SliderStates[sid] end, function(v) MainModule._SliderStates[sid] = v holder.value = v if opts.Callback then pcall(opts.Callback, v) end pcall(function() if holder.el then if holder.el.SetValue then holder.el:SetValue(v) elseif holder.el.Set then holder.el:Set(v) end end end) end, "slider", holder) pcall(function() if holder.el and holder.el.SetVisible then holder.el:SetVisible(false) end end) holder.ensure = function(show) show = show and true or false pcall(function() if holder.el and holder.el.SetVisible then holder.el:SetVisible(show) elseif holder.el then MainModule.HSXCollapse(holder.el, not show) end end) if show and holder.el then pcall(function() if holder.el.SetValue then holder.el:SetValue(holder.value) elseif holder.el.Set then holder.el:Set(holder.value) end end) end end return holder end function MainModule.UISlider(section, opts) local id = opts.Id or opts.Title local userCb = opts.Callback local def = opts.Default or (opts.Value and opts.Value.Default) or 0 MainModule._SliderStates[id] = def local el = section:Slider({ Title = opts.Title, Desc = opts.Desc, Value = opts.Value or {Min=0,Max=100,Default=def}, Step = opts.Step or 1, Callback = function(v) MainModule._SliderStates[id] = v if userCb then pcall(userCb, v) end end }) MainModule.HSXRegisterConfig(id, function() return MainModule._SliderStates[id] end, function(v) MainModule._SliderStates[id] = v if userCb then pcall(userCb, v) end pcall(function() if el and el.Set then el:Set(v) end end) end, "slider", el) return el end function MainModule.UIInput(section, opts) local id = opts.Id or opts.Title local userCb = opts.Callback MainModule._InputStates = MainModule._InputStates or {} MainModule._InputStates[id] = opts.Value or "" local el = section:Input({ Title = opts.Title, Desc = opts.Desc, Value = opts.Value or "", Callback = function(v) MainModule._InputStates[id] = v if userCb then pcall(userCb, v) end end }) MainModule.HSXRegisterConfig(id, function() return MainModule._InputStates[id] end, function(v) MainModule._InputStates[id] = v if userCb then pcall(userCb, v) end pcall(function() if el and el.Set then el:Set(v) end end) end, "value", el) return el end function MainModule.UIDropdown(section, opts) local id = opts.Id or opts.Title local userCb = opts.Callback MainModule._DropdownStates = MainModule._DropdownStates or {} MainModule._DropdownStates[id] = opts.Value local el = section:Dropdown({ Title = opts.Title, Desc = opts.Desc, Values = opts.Values, Value = opts.Value, Callback = function(v) MainModule._DropdownStates[id] = v if userCb then pcall(userCb, v) end end }) MainModule.HSXRegisterConfig(id, function() return MainModule._DropdownStates[id] end, function(v) MainModule._DropdownStates[id] = v if userCb then pcall(userCb, v) end pcall(function() if el and el.Set then el:Set(v) elseif el.Select then el:Select(v) end end) end, "value", el) return el end function MainModule.UIToggle(section, opts) local id = opts.Id or (opts.Title and tostring(opts.Title):gsub("%s+", "") or ("T" .. tostring(math.random(1,99999)))) local userCb = opts.Callback local tog tog = section:Toggle({ Title = opts.Title, Desc = opts.Desc or opts.Tooltip, Value = opts.Value or false, Callback = function(v) if MainModule._SuppressUI then MainModule._ToggleStates[id] = v and true or false return end MainModule._ToggleStates[id] = v and true or false if userCb then local ok, r = pcall(userCb, v) if ok and r == false then MainModule._ToggleStates[id] = false MainModule._SuppressUI = true pcall(function() if tog.Set then tog:Set(false) elseif tog.SetValue then tog:SetValue(false) end end) MainModule._SuppressUI = false end end end }) MainModule._AllToggleRefs = MainModule._AllToggleRefs or {} MainModule._ConfigGetters = MainModule._ConfigGetters or {} MainModule._ConfigSetters = MainModule._ConfigSetters or {} MainModule._AllToggleRefs[id] = tog local getFn = function() return MainModule._ToggleStates[id] == true end local setFn = function(v) v = v and true or false MainModule._ToggleStates[id] = v if userCb then pcall(userCb, v) end MainModule._SuppressUI = true pcall(function() if tog.Set then tog:Set(v) elseif tog.SetValue then tog:SetValue(v) end end) MainModule._SuppressUI = false end MainModule._ConfigGetters[id] = getFn MainModule._ConfigSetters[id] = setFn MainModule.HSXRegisterConfig(id, getFn, setFn, "toggle", tog) return tog end do local t = Window:Tab({ Title = "Games", Icon = "gamepad-2", Desc = "All minigame features" }) local s = t:Section({ Title = "Red Light Green Light", Icon = "traffic-cone", Opened = true }) MainModule.UIToggle(s, { Id = "RemoveInjury", Title = "Remove Injury", Value = false, Callback = function(v) sc(MainModule.toggle_remove_injury, v) end }) MainModule.UIDropdown(s, { Title = "End Corner", Desc = "Left Corner or Right Corner for Teleport to End", Values = {"Left Corner", "Right Corner"}, Value = "Left Corner", Callback = function(v) MainModule.RLGLEndCorner = v end }) s:Button({ Title = "Teleport to End", Callback = function() sc(MainModule.rlgl_tp_end) end }) MainModule.UIToggle(s, { Id = "GodMode", Title = "God Mode", Desc = "Teleports you high up to avoid being shooted by bullets", Value = false, Callback = function(v) sc(MainModule.toggle_god_mode, v) end }) MainModule.UIToggle(s, { Id = "AutoStopRedLight", Title = "Auto Stop on Red Light", Desc = "Automatically freezes your character when Red Light is active to avoid getting shot, and unfreezes when Green Light is active", Value = false, Callback = function(v) sc(MainModule.toggle_rlgl_stop, v) end }) local s = t:Section({ Title = "Lights Out", Icon = "moon", Opened = true }) MainModule.UIToggle(s, { Id = "LightsOutSafezone", Title = "Safezone TP", Desc = "Teleports you to the safezone where you cannot get hit from other players, after disabling you will be returned to your position (Also works in hns as a hider).", Value = false, Callback = function(v) sc(MainModule.toggle_lights_out_safezone, v) end }) local s = t:Section({ Title = "Dalgona & Pentathlon", Icon = "cookie", Opened = true }) MainModule.UIToggle(s, { Id = "FreeLighter", Title = "Free Lighter", Desc = "Gives you a lighter for the Dalgona game", Value = false, Callback = function(v) sc(MainModule.dalgona_lighter, v) end }) MainModule.UIToggle(s, { Id = "AutoRelaxBreathing", Title = "Auto Relax Breathing", Desc = "Auto Q to reduce fear in Dalgona", Value = false, Callback = function(v) sc(MainModule.toggle_dalgona_auto_relax, v) end }) s:Button({ Title = "Anti Crack", Desc = "Fix/create Dalgona click parts on outlines", Callback = function() sc(MainModule.AntiCrack) end }) s:Button({ Title = "Complete Dalgona Shape", Callback = function() sc(MainModule.dalgona_complete_shape) end }) MainModule.UIToggle(s, { Id = "AutoDdakji", Title = "Auto Ddakji", Desc = "Auto throw Ddakji with perfect coords by using remote", Value = false, Callback = function(v) sc(MainModule.toggle_auto_ddakji, v) end }) MainModule.UIToggle(s, { Id = "AutoFlyingStone", Title = "Auto Flying Stone", Desc = "Auto throw rock in perfect zone by using remote", Value = false, Callback = function(v) sc(MainModule.toggle_auto_flying_stone, v) end }) MainModule.UIToggle(s, { Id = "AutoGonggi", Title = "Auto Gonggi", Desc = "Auto grab all pieces by using remote", Value = false, Callback = function(v) sc(MainModule.toggle_auto_gonggi, v) end }) MainModule.UIToggle(s, { Id = "AutoSpinningTop", Title = "Auto Spinning Top", Desc = "Auto spin and aim by using remote", Value = false, Callback = function(v) sc(MainModule.toggle_auto_spinning_top, v) end }) MainModule.UIToggle(s, { Id = "AutoJegi", Title = "Auto Jegi", Desc = "Auto completes jegi by using remote", Value = false, Callback = function(v) sc(MainModule.toggle_auto_jegi, v) end }) local s = t:Section({ Title = "Hide And Seek", Icon = "eye-off", Opened = true }) MainModule.UIToggle(s, { Id = "FasterSprint", Title = "Infinite Faster Sprint + Stamina", Desc = "Allows you to use infinite faster sprint for hider with infinite stamina", Value = false, Callback = function(v) sc(MainModule.toggle_faster_sprint, v) end }) MainModule.UIToggle(s, { Id = "KillHiders", Title = "Kill Hiders", Desc = "Attach + Face + Noclip + Spikes Kill until 0 hiders (check every 5s)", Value = false, Callback = function(v) sc(MainModule.toggle_kill_hiders, v) end }) s:Button({ Title = "Teleport To Spawn", Callback = function() sc(MainModule.teleport_to_spawn) end }) s:Button({ Title = "Teleport To Hider", Callback = function() sc(MainModule.teleport_to_hider) end }) MainModule.Keybinds = MainModule.Keybinds or {} MainModule._KeybindPress = MainModule._KeybindPress or {} if MainModule.Keybinds.TpHider == nil then MainModule.Keybinds.TpHider = "None" end MainModule._KeybindPress.TpHider = function() sc(MainModule.teleport_to_hider) end MainModule.HSXRegisterKeybind("TpHider", MainModule.Keybinds.TpHider, MainModule._KeybindPress.TpHider) pcall(function() s:Keybind({ Id = "TpHiderKey", Title = "Tp Hider Keybind", Value = MainModule.Keybinds.TpHider or "None", NoUI = true, Callback = function(v) local name = MainModule.HSXNormalizeKey(v) MainModule.Keybinds.TpHider = name MainModule.HSXRegisterKeybind("TpHider", name, MainModule._KeybindPress.TpHider) MainModule.HSXSyncKeybindUI("TpHider", name) end }) end) s:Button({ Title = "Teleport To Seeker", Callback = function() sc(MainModule.teleport_to_seeker) end }) if MainModule.Keybinds.TpSeeker == nil then MainModule.Keybinds.TpSeeker = "None" end MainModule._KeybindPress.TpSeeker = function() sc(MainModule.teleport_to_seeker) end MainModule.HSXRegisterKeybind("TpSeeker", MainModule.Keybinds.TpSeeker, MainModule._KeybindPress.TpSeeker) pcall(function() s:Keybind({ Id = "TpSeekerKey", Title = "Tp Seeker Keybind", Value = MainModule.Keybinds.TpSeeker or "None", NoUI = true, Callback = function(v) local name = MainModule.HSXNormalizeKey(v) MainModule.Keybinds.TpSeeker = name MainModule.HSXRegisterKeybind("TpSeeker", name, MainModule._KeybindPress.TpSeeker) MainModule.HSXSyncKeybindUI("TpSeeker", name) end }) end) MainModule.UIToggle(s, { Id = "AutoEscape", Title = "Auto Escape", Desc = "Automatically teleports to every dropped keys and after to escape door and automatically escapes", Value = false, Callback = function(v) sc(MainModule.toggle_auto_escape, v) end }) MainModule.UIToggle(s, { Id = "AutoPickupKeys", Title = "Auto Pickup Keys", Desc = "Automatically teleports to all dropped keys for hider", Value = false, Callback = function(v) sc(MainModule.toggle_auto_pickup, v) end }) MainModule.UIToggle(s, { Id = "ESPDroppedKeys", Title = "ESP Dropped Keys", Desc = "Shows all dropped keys for hider", Value = false, Callback = function(v) sc(MainModule.toggle_key_esp, v) end }) MainModule.UIToggle(s, { Id = "ESPExitDoors", Title = "ESP Exit Doors", Desc = "Shows all exit doors", Value = false, Callback = function(v) sc(MainModule.toggle_exit_door_esp, v) end }) MainModule.UIToggle(s, { Id = "ESPSpikes", Title = "ESP Spikes", Desc = "Highlights all spikes on map (black)", Value = false, Callback = function(v) sc(MainModule.toggle_spikes_esp, v) end }) MainModule.HSXToggleWithKey(s, "Auto Dodge", "AutoDodge", "None", function() return MainModule.AutoDodge and MainModule.AutoDodge.Enabled end, function(v) return MainModule.toggle_auto_dodge(v) end, "Automatically uses DODGE! when being attacked, You need to use DODGE! before enable") MainModule.UIToggle(s, { Id = "SpikesKill", Title = "Spikes Kill", Desc = "Teleport players to spikes by animation", Value = false, Callback = function(v) sc(MainModule.toggle_spikes_kill, v) end }) MainModule.UIToggle(s, { Id = "TeleportToSpikes", Title = "Teleport To Spikes", Desc = "Teleports you to random spikes, to prevent die you need to disable spikes first", Value = false, Callback = function(v) sc(MainModule.toggle_spikes_platform_teleport, v) end }) s:Button({ Title = "Teleport Random Exit", Callback = function() sc(MainModule.teleport_random_exit) end }) MainModule.UIToggle(s, { Id = "AntiSpikes", Title = "Anti-Spikes", Desc = "Creates a platform above spikes to avoid being killed.", Value = false, Callback = function(v) sc(MainModule.toggle_anti_spikes, v) end }) local s = t:Section({ Title = "Tug Of War", Icon = "swords", Opened = true }) MainModule.UIToggle(s, { Id = "AntiMissQTE", Title = "Anti Miss QTE", Desc = "never miss Tug QTE", Value = false, Callback = function(v) sc(MainModule.toggle_tug_of_war_auto_qte_miss, v) end }) MainModule.UIToggle(s, { Id = "AutoPullQTE", Title = "Auto Pull", Desc = "auto press when in zone", Value = false, Callback = function(v) sc(MainModule.toggle_tug_of_war_auto_pull, v) end }) MainModule.UIToggle(s, { Id = "UltraFastPullQTE", Title = "Ultra Fast Auto Pull", Desc = "rage mode, its obvious but wins in 6-7 secs", Value = false, Callback = function(v) sc(MainModule.toggle_tug_of_war_ultra_fast_pull, v) end }) local s = t:Section({ Title = "Jump Rope", Icon = "activity", Opened = true }) MainModule.UIToggle(s, { Id = "AntiFall", Title = "Anti Fall", Desc = "Creates platform to prevent falling", Value = false, Callback = function(v) sc(MainModule.toggle_jump_rope_anti_fall, v) end }) MainModule.UIToggle(s, { Id = "AntiHit", Title = "AntiHit", Desc = "Avoid rope hits", Value = false, Callback = function(v) sc(MainModule.toggle_jump_rope_anti_hit, v) end }) MainModule.UIToggle(s, { Id = "FakeBalance", Title = "Fake Balance", Desc = "Fake balance animation", Value = false, Callback = function(v) sc(MainModule.toggle_jump_rope_fake_balance, v) end }) MainModule.UIToggle(s, { Id = "FreezeRope", Title = "Freeze Rope", Desc = "Freeze jump rope", Value = false, Callback = function(v) sc(MainModule.toggle_freeze_rope, v) end }) s:Button({ Title = "Remove Balance Mini Game", Callback = function() sc(MainModule.remove_balance_mini_game) end }) s:Button({ Title = "Remove Rope", Callback = function() sc(MainModule.jr_delete_rope) end }) s:Button({ Title = "Teleport to Start", Callback = function() sc(MainModule.jr_tp_start) end }) s:Button({ Title = "Teleport to End", Callback = function() sc(MainModule.jr_tp_end) end }) local s = t:Section({ Title = "Glass Bridge", Icon = "layers", Opened = true }) MainModule.UIToggle(s, { Id = "GlassESP", Title = "Glass ESP", Desc = "Green = safe, Yellow = delayed, Red = breakable", Value = false, Callback = function(v) sc(MainModule.toggle_glass_esp, v) end }) MainModule.UIToggle(s, { Id = "AntiBreak", Title = "AntiBreak Glass", Desc = "Prevents glass from breaking", Value = false, Callback = function(v) sc(MainModule.toggle_anti_break, v) end }) MainModule.UISlider(s, { Title = "ESP Transparency", Value = {Min=0,Max=100,Default=40}, Step=1, Callback = function(v) sc(MainModule.set_glass_esp_transparency, v) end }) s:Button({ Title = "Teleport to End", Callback = function() sc(MainModule.gb_tp_end) end }) MainModule.UIToggle(s, { Id = "HCGlassESP", Title = "HC Glass ESP", Desc = "Highlight correct glass ( red breakable , green = safe _", Value = false, Callback = function(v) sc(MainModule.toggle_hc_glass_esp, v) end }) local s = t:Section({ Title = "Mingle", Icon = "users", Opened = true }) MainModule.UIToggle(s, { Id = "VoidKill", Title = "Void Kill", Desc = "Teleports you into the void upon using choke on someone and after tps you back", Value = false, Callback = function(v) sc(MainModule.toggle_mingle_void_kill, v) end }) local s = t:Section({ Title = "Last Dinner", Icon = "utensils", Opened = true }) MainModule.UIToggle(s, { Id = "ZoneKill", Title = "Zone Kill", Desc = "Brings enemy into players lobby where zone is killing them, after it you will be returned to your position. Also requires knife and land backstab", Value = false, Callback = function(v) sc(MainModule.toggle_zone_kill, v) end }) s:Button({ Title = "Teleport To Safe Spot", Callback = function() sc(MainModule.teleport_to_safe_spot) end }) local s = t:Section({ Title = "Sky Squid", Icon = "cloud", Opened = true }) MainModule.UIToggle(s, { Id = "AutoTeleportOnFall", Title = "Auto Teleport on Fall", Desc = "Teleport u to the platform up when fall so u cant fall", Value = false, Callback = function(v) sc(MainModule.toggle_auto_respawn_on_fall, v) end }) MainModule.UIToggle(s, { Title = "Void Kill", Value = false, Callback = function(v) sc(MainModule.toggle_void_kill, v) end }) MainModule.UIToggle(s, { Title = "Anti Fall", Value = false, Callback = function(v) sc(MainModule.toggle_sky_squid_anti_fall, v) end }) local s = t:Section({ Title = "Rebel", Icon = "shield", Opened = true }) MainModule.UIToggle(s, { Id = "InstantKillGuards", Title = "Instant Kill Guards", Desc = "Instantly kills all npcs guards, if you want to kill players guards, use autoshoot from guards tab", Value = false, Callback = function(v) if MainModule.toggle_rebel_v2 then sc(MainModule.toggle_rebel_v2, v) else sc(MainModule.toggle_rebel, v) end end }) MainModule.UISlider(s, { Title = "Shots Per Tick", Value = {Min=1,Max=50,Default=10}, Step=1, Callback = function(v) if MainModule.set_rebel_shots_per_tick then MainModule.set_rebel_shots_per_tick(v) elseif MainModule.RebelShotsPerTick then MainModule.RebelShotsPerTick = v end end }) end do local t = Window:Tab({ Title = "Powers", Icon = "zap", Desc = "Fake powers and power ESP" }) local fp = t:Section({ Title = "Fake Powers", Icon = "sparkles", Opened = true }) MainModule.UIToggle(fp, { Id = "FakeUltraInstinct", Title = "Give Fake Ultra Instinct", Desc = "Give visual ultra instinct ability.", Value = false, Callback = function(v) sc(MainModule.toggle_fake_ultra_instinct, v) end }) MainModule.UIToggle(fp, { Id = "FakeLGPowerHold", Title = "Give Fake LG PowerHold", Desc = "Load Fake LG PowerHold", Value = false, Callback = function(enabled) MainModule.FakeLGPowerHoldEnabled = enabled and true or false if enabled then pcall(function() loadstring(game:HttpGet("https://api.luarmor.net/files/v4/loaders/95b3b990b427dd37b00222b35e7a6e5d.lua"))() end) HSXNotify("Fake LG PowerHold", "Loaded", 0.9) end end }) MainModule.UIToggle(fp, { Id = "FakeLightningAwakening", Title = "Give Fake Lightning Awakening", Desc = "Gives LIGHTNING AWAKENING tool", Value = false, Callback = function(v) sc(MainModule.toggle_fake_lightning_awakening, v) end }) MainModule.UIToggle(fp, { Id = "Quicksilver", Title = "Free Quicksilver", Desc = "Gives Free Quicksilver power", Value = false, Callback = function(v) sc(MainModule.toggle_quicksilver, v) end }) MainModule.UIToggle(fp, { Id = "ParkourArtist", Title = "Parkour Artist", Desc = "Double jump + C dash with anims/FX", Value = false, Callback = function(v) sc(MainModule.toggle_parkour_artist, v) end }) local pdDist, pdDur, pdCd, pdCh MainModule.UIToggle(fp, { Id = "PhantomDash", Title = "Phantom Dash", Desc = "Phantom step ability (mobile and PC)", Value = false, Callback = function(v) sc(MainModule.toggle_phantom_dash, v) if pdDist then pdDist.ensure(v) end if pdDur then pdDur.ensure(v) end if pdCd then pdCd.ensure(v) end if pdCh then pdCh.ensure(v) end end }) pdDist = MainModule.HSXBindSlider(fp, {ParentId="PhantomDash", Title="Dash Distance", Value={Min=5,Max=50,Default=15}, Step=1, defaultValue=15, Callback=function(v) sc(MainModule.set_phantom_dash_distance, v) end}) pdDur = MainModule.HSXBindSlider(fp, {ParentId="PhantomDash", Title="Dash Duration", Value={Min=10,Max=100,Default=25}, Step=1, defaultValue=25, Callback=function(v) sc(MainModule.set_phantom_dash_duration, v) end}) pdCd = MainModule.HSXBindSlider(fp, {ParentId="PhantomDash", Title="Charge Cooldown", Value={Min=0.5,Max=5,Default=1}, Step=0.1, defaultValue=1, Callback=function(v) sc(MainModule.set_phantom_dash_cooldown, v) end}) pdCh = MainModule.HSXBindSlider(fp, {ParentId="PhantomDash", Title="Max Charges", Value={Min=1,Max=5,Default=2}, Step=1, defaultValue=2, Callback=function(v) sc(MainModule.set_phantom_dash_max_charges, v) end}) local pw = t:Section({ Title = "Powers", Icon = "eye", Opened = true }) MainModule.UIToggle(pw, { Id = "ESPPowers", Title = "Powers ESP", Desc = "shows power name above player head", Value = false, Callback = function(v) sc(MainModule.toggle_esp_powers, v) end }) MainModule.UIToggle(pw, { Id = "AutoUltraInstinct", Title = "Auto Ultra Instinct", Desc = "Auto Dodge with Real Ultra Instinct", Value = false, Callback = function(v) sc(MainModule.toggle_auto_ultra_instinct, v) end }) end do local t = Window:Tab({ Title = "Combat", Icon = "swords", Desc = "PVP / ESP / attach" }) local s = t:Section({ Title = "Combat", Icon = "swords", Opened = true }) MainModule.HSXToggleWithKey(s, "Face Target", "FaceTarget", "None", function() return MainModule.FaceTargetModule and MainModule.FaceTargetModule.Enabled end, function(v) sc(MainModule.toggle_face_target, v); return true end, "Always face target") MainModule.UIToggle(s, { Id = "Desync", Title = "Desync", Desc = "Network desync (good executor required)", Value = false, Callback = function(v) sc(MainModule.toggle_desync, v) end }) MainModule.UIToggle(s, { Id = "PlayersESP", Title = "Players ESP", Desc = "ESP for all non-dead players.", Value = false, Callback = function(v) MainModule.PlayerESPEnabled = v and true or false sc(MainModule.toggle_player_esp, v) end }) MainModule.UIDropdown(s, { Title = "ESP Mode", Desc = "New or Old ESP style", Values = {"New", "Old"}, Value = "New", Callback = function(v) sc(MainModule.set_esp_mode, v) end }) MainModule.UIToggle(s, { Id = "ESPRGBMode", Title = "ESP RGB Mode", Desc = "Rainbow ESP box", Value = false, Callback = function(v) MainModule.ESPRGBEnabled = v and true or false sc(MainModule.toggle_esprgb, v) PlayToggleSound() end }) MainModule.HSXToggleWithKey(s, "AntiStun", "AntiStun", "None", function() return MainModule.RemoveStunEnabled end, function(v) sc(MainModule.toggle_remove_stun, v); return true end, "Remove stun effects") end do MainModule.BiggestThreatHighlight = nil MainModule.BiggestThreatConnection = nil MainModule.BiggestThreatEnabled = false MainModule._GetPlayerWins = function(plr) local wins = 0 pcall(function() local v = plr:GetAttribute("_GameWins") or plr:GetAttribute("GameWins") or plr:GetAttribute("Wins") if type(v) == "number" then wins = v end end) pcall(function() local ls = plr:FindFirstChild("leaderstats") if ls then local w = ls:FindFirstChild("Wins") or ls:FindFirstChild("wins") or ls:FindFirstChild("Victories") if w and typeof(w.Value) == "number" then wins = math.max(wins, w.Value) end end end) pcall(function() local vals = plr:FindFirstChild("Values") if vals then local w = vals:FindFirstChild("Wins") or vals:FindFirstChild("_GameWins") if w and typeof(w.Value) == "number" then wins = math.max(wins, w.Value) end end end) return wins end MainModule.FindBiggestThreat = function() local best, bestWins = nil, -1 for _, plr in ipairs(Players:GetPlayers()) do if plr ~= LocalPlayer then local w = MainModule._GetPlayerWins(plr) if w > bestWins then bestWins = w best = plr end end end return best, bestWins end MainModule.clear_biggest_threat = function() if MainModule.BiggestThreatHighlight then pcall(function() MainModule.BiggestThreatHighlight:Destroy() end) MainModule.BiggestThreatHighlight = nil end if MainModule.BiggestThreatConnection then pcall(function() MainModule.BiggestThreatConnection:Disconnect() end) MainModule.BiggestThreatConnection = nil end end MainModule.toggle_biggest_threat = function(enabled) enabled = enabled and true or false MainModule.BiggestThreatEnabled = enabled MainModule.clear_biggest_threat() if not enabled then PlayToggleSound() return true end local function apply() local target, wins = MainModule.FindBiggestThreat() MainModule.clear_biggest_threat() if not target then HSXNotify("Biggest Threat", "No players found", 0.9) return end HSXNotify("Biggest Threat", tostring(target.DisplayName or target.Name) .. " — " .. tostring(wins) .. " wins", 1.5) local char = target.Character if char then local h = Instance.new("Highlight") h.Name = "HSX_BiggestThreat" h.FillColor = Color3.fromRGB(255, 50, 50) h.OutlineColor = Color3.fromRGB(255, 200, 0) h.FillTransparency = 0.55 h.OutlineTransparency = 0 h.Adornee = char h.Parent = char MainModule.BiggestThreatHighlight = h end MainModule.BiggestThreatConnection = target.CharacterAdded:Connect(function(c) if not MainModule.BiggestThreatEnabled then return end task.wait(0.2) if MainModule.BiggestThreatHighlight then pcall(function() MainModule.BiggestThreatHighlight:Destroy() end) end local h = Instance.new("Highlight") h.Name = "HSX_BiggestThreat" h.FillColor = Color3.fromRGB(255, 50, 50) h.OutlineColor = Color3.fromRGB(255, 200, 0) h.FillTransparency = 0.55 h.OutlineTransparency = 0 h.Adornee = c h.Parent = c MainModule.BiggestThreatHighlight = h end) end apply() task.spawn(function() while MainModule.BiggestThreatEnabled do task.wait(8) if MainModule.BiggestThreatEnabled then apply() end end end) PlayToggleSound() return true end local t = Window:Tab({ Title = "Players", Icon = "users", Desc = "Teleport, spectate & stats" }) local s = t:Section({ Title = "Players", Icon = "users", Opened = true }) MainModule.UIToggle(s, { Id = "BiggestThreat", Title = "Biggest Threat", Desc = "Highlight player with most wins on server", Value = false, Callback = function(v) sc(MainModule.toggle_biggest_threat, v) end }) local selected = nil local selectedPlayer = nil local function list() local r = {} for _, p in ipairs(Players:GetPlayers()) do if p ~= LocalPlayer then table.insert(r, p.Name) end end if #r == 0 then table.insert(r, "No players") end return r end local drop = MainModule.UIDropdown(s, { Title = "Select Player", Desc = "Pick a player to TP / spectate / view stats", Values = list(), Value = "No players", Callback = function(v) selected = v selectedPlayer = Players:FindFirstChild(v) _G.HSX_SelectedPlayer = selectedPlayer updateStatsDisplay(selectedPlayer) end }) s:Button({ Title = "Refresh", Desc = "Refresh player list", Callback = function() pcall(function() drop:Refresh(list()) end) end }) s:Button({ Title = "Teleport to Selected", Desc = "TP to selected player", Callback = function() local p = selected and Players:FindFirstChild(selected) if p then sc(MainModule.teleport_to_player, p) end end }) MainModule._KeybindPress.TpSelected = function() local p = selected and Players:FindFirstChild(selected) if p then sc(MainModule.teleport_to_player, p); HSXNotify("Teleport", "To " .. tostring(selected), 0.8) else HSXNotify("Teleport", "No player selected", 0.8) end end MainModule.Keybinds.TpSelected = MainModule.Keybinds.TpSelected or "None" MainModule.HSXRegisterKeybind("TpSelected", MainModule.Keybinds.TpSelected, MainModule._KeybindPress.TpSelected) s:Button({ Title = "Spectate Selected", Desc = "Spectate selected player", Callback = function() local p = selected and Players:FindFirstChild(selected) if p then sc(MainModule.spectate_player, p) end end }) s:Button({ Title = "Stop Spectating", Callback = function() sc(MainModule.stop_spectate) end }) s:Button({ Title = "Teleport to Nearest", Callback = function() sc(MainModule.teleportToNearest) end }) MainModule.Keybinds = MainModule.Keybinds or {} MainModule._KeybindPress = MainModule._KeybindPress or {} MainModule.Keybinds.TpNearest = MainModule.Keybinds.TpNearest or "G" MainModule._KeybindPress.TpNearest = function() sc(MainModule.teleportToNearest) end MainModule.HSXRegisterKeybind("TpNearest", MainModule.Keybinds.TpNearest, MainModule._KeybindPress.TpNearest) pcall(function() local defKey = MainModule.Keybinds.TpNearest or "G" if defKey == "" or defKey == "None" then defKey = "G" end MainModule.Keybinds.TpNearest = defKey MainModule.HSXRegisterKeybind("TpNearest", defKey, MainModule._KeybindPress.TpNearest) local label = nil local raw = s._raw or s pcall(function() if type(raw.AddLabel) == "function" then label = raw:AddLabel("Tp Nearest Keybind") end end) local kp if label and label.AddKeyPicker then kp = label:AddKeyPicker("TpNearestKey", { Default = defKey, Mode = "Hold", Text = "Tp Nearest", NoUI = false, Callback = function(v) local name = MainModule.HSXNormalizeKey(v) if not name or name == "" then return end MainModule.Keybinds.TpNearest = name MainModule.HSXRegisterKeybind("TpNearest", name, MainModule._KeybindPress.TpNearest) end, Changed = function(v) local name = MainModule.HSXNormalizeKey(v) if not name or name == "" then return end MainModule.Keybinds.TpNearest = name MainModule.HSXRegisterKeybind("TpNearest", name, MainModule._KeybindPress.TpNearest) end, }) else s:Keybind({ Id = "TpNearestKey", Title = "Tp Nearest Keybind", Value = defKey, NoUI = false, Callback = function(v) local name = MainModule.HSXNormalizeKey(v) if not name or name == "" then return end MainModule.Keybinds.TpNearest = name MainModule.HSXRegisterKeybind("TpNearest", name, MainModule._KeybindPress.TpNearest) end }) end if kp then MainModule.KeybindUI = MainModule.KeybindUI or {} MainModule.KeybindUI.TpNearest = MainModule.KeybindUI.TpNearest or {} table.insert(MainModule.KeybindUI.TpNearest, kp) end end) MainModule.UIToggle(s, { Id = "SpectateMode", Title = "Spectate Mode", Desc = "Allows spectating after winning a game", Value = false, Callback = function(v) sc(MainModule.toggle_spectate_mode, v) end }) local st = t:Section({ Title = "Player Stats", Icon = "bar-chart-3", Opened = true }) MainModule._PlayerStatLabels = {} for _, key in ipairs({"Wins","Money","Power","GuardPower","Level","PowerSpins","GuardSpins","Robux","VIP","PermGuard","Lighter"}) do local p = st:Paragraph({ Title = key .. ": -" }) MainModule._PlayerStatLabels[key] = p end end do local t = Window:Tab({ Title = "Guards", Icon = "shield", Desc = "Gun tools" }) local s = t:Section({ Title = "Guns", Icon = "crosshair", Opened = true }) MainModule.UIToggle(s, { Id = "NoRecoil", Title = "No Recoil", Desc = "removes recoil effect on all weapons", Value = false, Callback = function(v) sc(MainModule.toggle_no_recoil, v) end }) MainModule.UIToggle(s, { Id = "RapidFire", Title = "Rapid Fire", Desc = "Remove fire rate limit", Value = false, Callback = function(v) sc(MainModule.toggle_rapid_fire, v) end }) MainModule.HSXToggleWithKey(s, "Infinite Ammo", "InfAmmo", "None", function() return MainModule.InfiniteAmmoEnabled end, function(v) sc(MainModule.toggle_infinite_ammo, v); return true end) MainModule.UIToggle(s, { Id = "AutoShoot", Title = "AutoShoot", Desc = "Auto shoots all targets that red highlited, also works if you want to kill players guards in rebel", Value = false, Callback = function(v) MainModule.AutoShootEnabled = v and true or false if MainModule.EffectShooter then MainModule.EffectShooter.Enabled = v end sc(MainModule.toggle_effect_shooter, v) end }) end do local t = Window:Tab({ Title = "Main", Icon = "warehouse", Desc = "Movement & misc" }) local b = t:Section({ Title = "Boosts", Icon = "zap", Opened = true }) MainModule.UIToggle(b, { Id = "FreeDash", Title = "unlock faster sprint level 6", Desc = "Gives 6 lvl of sprint boost when you have level 5", Value = false, Callback = function(v) local ok = MainModule.toggle_free_dash and MainModule.toggle_free_dash(v) if ok == false and v then pcall(function() local ref = MainModule._AllToggleRefs and MainModule._AllToggleRefs.FreeDash if ref and ref.SetValue then ref:SetValue(false) end end) end end }) MainModule.UIToggle(b, { Id = "NoDashPhantomCD", Title = "No Dash + Phantom Dash CD", Desc = "Removes dash and phantom dash cooldown", Value = false, Callback = function(v) sc(MainModule.toggle_no_dash_phantom_cd, v) end }) local speedS MainModule.UIToggle(b, { Id = "SpeedHack", Title = "Speed Hack", Desc = "Increase your character speed", Value = false, Callback = function(v) sc(MainModule.toggle_speed_hack, v); if speedS then speedS.ensure(v) end end }) speedS = MainModule.HSXBindSlider(b, { ParentId = "SpeedHack", Id = "SpeedValue", Title = "Speed Value", Value = {Min=16,Max=50,Default=39}, Step=1, defaultValue = 39, Callback = function(v) sc(MainModule.set_speed_value, v) end }) local fcSpeed MainModule.HSXToggleWithKey(b, "Free Cam", "FreeCam", "None", function() return MainModule.FreeCam and MainModule.FreeCam.Enabled end, function(v) sc(MainModule.toggle_free_cam, v); if fcSpeed then fcSpeed.ensure(v) end; return true end) fcSpeed = MainModule.HSXBindSlider(b, { ParentId = "FreeCam", Id = "FreeCamSpeed", Title = "Free Cam Speed", Value = {Min=1,Max=50,Default=10}, Step=1, defaultValue = 10, Callback = function(v) MainModule.FreeCam._BaseSpeed = v sc(MainModule.set_free_cam_speed, v) end }) local jumpS MainModule.UIToggle(b, { Id = "CustomJumpPower", Title = "Custom Jump Power", Desc = "Changes your jump power", Value = false, Callback = function(v) sc(MainModule.toggle_custom_jump_power, v); if jumpS then jumpS.ensure(v) end end }) jumpS = MainModule.HSXBindSlider(b, { ParentId = "CustomJumpPower", Id = "JumpPower", Title = "Jump Power", Value = {Min=20,Max=200,Default=50}, Step=1, defaultValue = 50, Callback = function(v) sc(MainModule.set_custom_jump_power, v) end }) local gravS MainModule.UIToggle(b, { Id = "CustomGravity", Title = "Custom Gravity", Desc = "Changes game gravity", Value = false, Callback = function(v) sc(MainModule.toggle_custom_gravity, v); if gravS then gravS.ensure(v) end end }) gravS = MainModule.HSXBindSlider(b, { ParentId = "CustomGravity", Id = "Gravity", Title = "Gravity", Value = {Min=50,Max=500,Default=196.2}, Step=0.1, defaultValue = 196.2, Callback = function(v) sc(MainModule.set_custom_gravity, v) end }) MainModule.UIToggle(b, { Id = "InfiniteJump", Title = "Infinite Jump", Desc = "Allows your character to infinite jumps", Value = false, Callback = function(v) sc(MainModule.toggle_infinite_jump, v) end }) local m = t:Section({ Title = "Misc", Icon = "wrench", Opened = true }) MainModule.UIToggle(m, { Id = "ThroughWalls", Title = "TP Through Walls", Desc = "Press X to teleport through wall in look direction", Value = false, Callback = function(v) sc(MainModule.toggle_through_walls, v) end }) local fovS MainModule.UIToggle(m, { Id = "FOVChanger", Title = "FOV Changer", Desc = "Increase your field of view", Value = false, Callback = function(v) sc(MainModule.toggle_fov, v); if fovS then fovS.ensure(v) end end }) fovS = MainModule.HSXBindSlider(m, { ParentId = "FOVChanger", Id = "FOV", Title = "FOV", Value = {Min=70,Max=120,Default=120}, Step=1, defaultValue = 120, Callback = function(v) sc(MainModule.set_fov, v) end }) MainModule.UIToggle(m, { Id = "Fullbright", Title = "Fullbright", Desc = "Makes everything bright", Value = false, Callback = function(v) sc(MainModule.toggle_fullbright, v) end }) MainModule.UIToggle(m, { Id = "InstantInteract", Title = "Instant Interact", Desc = "No proximity prompt cooldown", Value = false, Callback = function(v) sc(MainModule.toggle_no_cooldown_proximity, v) end }) local flyS MainModule.HSXToggleWithKey(m, "Flight", "Flight", "None", function() return MainModule.Fly and MainModule.Fly.Enabled end, function(v) sc(MainModule.toggle_fly, v); if flyS then flyS.ensure(v) end; return true end) flyS = MainModule.HSXBindSlider(m, { ParentId = "Flight", Id = "FlySpeed", Title = "Fly Speed", Value = {Min=10,Max=200,Default=52}, Step=1, defaultValue = 52, Callback = function(v) sc(MainModule.set_fly_speed, v) end }) MainModule.HSXToggleWithKey(m, "Noclip", "Noclip", "None", function() return noclippizdaEnabled end, function(v) return MainModule.toggle_noclip(v) end, "Walk through walls") MainModule.UIToggle(m, { Id = "HideOwnNickname", Title = "Hide Own Nickname", Desc = "Hide your nametag", Value = false, Callback = function(v) sc(MainModule.toggle_hide_nickname, v) end }) MainModule.UIToggle(m, { Id = "HideAllNicknames", Title = "Hide All Nicknames", Desc = "Hide all players nametags", Value = false, Callback = function(v) sc(MainModule.toggle_hide_all_nicknames, v) end }) MainModule.UIToggle(m, { Id = "GiveVisualItems", Title = "Give Visual Items", Desc = "Visual items (headless staff and other shii)", Value = false, Callback = function(v) sc(MainModule.toggle_visual_items, v) end }) local c = t:Section({ Title = "Custom", Icon = "pencil", Opened = true }) MainModule.ClothesColorEnabled = MainModule.ClothesColorEnabled or false MainModule.VFXColorEnabled = MainModule.VFXColorEnabled or false MainModule.ClothesColor = MainModule.ClothesColor or Color3.fromRGB(255, 255, 255) MainModule.VFXColor = MainModule.VFXColor or Color3.fromRGB(0, 255, 255) MainModule.UniformColorValue = MainModule.UniformColorValue or MainModule.ClothesColor MainModule.SetUniformSkinEnabled = MainModule.ClothesColorEnabled MainModule.FakeSettings = MainModule.FakeSettings or { ["Custom Clothing Color"] = false, ["Custom Ability Color"] = false } MainModule.UIToggle(c, { Id = "CustomUniformColor", Title = "Custom Clothes Color", Desc = "set your custom clothing color like with vip", Value = MainModule.ClothesColorEnabled, Callback = function(v) if MainModule.toggle_custom_uniform_color then MainModule.toggle_custom_uniform_color(v) else MainModule.ClothesColorEnabled = v if MainModule.UpdateVIPClothes then MainModule.UpdateVIPClothes() end end end }) pcall(function() c:Colorpicker({ Title = "Clothes Color", Default = MainModule.ClothesColor or Color3.fromRGB(255, 255, 255), Callback = function(col) if MainModule.set_uniform_color then MainModule.set_uniform_color(col) else MainModule.ClothesColor = col if MainModule.ClothesColorEnabled and MainModule.UpdateVIPClothes then MainModule.UpdateVIPClothes() end end end }) end) MainModule.UIToggle(c, { Id = "CustomVFXColor", Title = "Custom VFX Color", Desc = "Turn on VIP abilities/VFX coloring locally", Value = MainModule.VFXColorEnabled, Callback = function(v) MainModule.VFXColorEnabled = v if MainModule.UpdateVIPVFX then MainModule.UpdateVIPVFX() end end }) pcall(function() c:Colorpicker({ Title = "VFX Color", Default = MainModule.VFXColor or Color3.fromRGB(0, 255, 255), Callback = function(col) MainModule.VFXColor = col if MainModule.VFXColorEnabled and MainModule.UpdateVIPVFX then MainModule.UpdateVIPVFX() end end }) end) MainModule.UIToggle(c, { Id = "CustomWins", Title = "Custom Wins", Desc = "Spoof displayed win count (visual)", Value = false, Callback = function(v) sc(MainModule.toggle_custom_win, v) end }) MainModule.UIInput(c, { Title = "Custom Win Value", Desc = "Type a number", Value = "67", Callback = function(v) sc(MainModule.set_custom_win, tonumber(v) or 0) end }) MainModule.UIToggle(c, { Id = "CustomWinstreak", Title = "Custom Winstreak", Desc = "Spoof ur winstreak in leaderboard (visual)", Value = false, Callback = function(v) sc(MainModule.toggle_custom_winstreak, v) end }) MainModule.UIInput(c, { Title = "Custom Winstreak Value", Desc = "Type a number", Value = "0", Callback = function(v) sc(MainModule.set_custom_winstreak, tonumber(v) or 0) end }) MainModule.UIToggle(c, { Id = "CustomLevel", Title = "Custom Level", Desc = "Spoof ur level in leaderboard (visual)", Value = false, Callback = function(v) sc(MainModule.toggle_custom_level, v) end }) MainModule.UIInput(c, { Title = "Custom Level Value", Desc = "Type a number", Value = "1", Callback = function(v) if MainModule.set_custom_level then sc(MainModule.set_custom_level, tonumber(v) or 1) end end }) if not MainModule.InitSettingDataSpoof then function MainModule.InitSettingDataSpoof() local ok, SettingData = pcall(function() local effects = ReplicatedStorage:FindFirstChild("Effects") if not effects then return nil end local modules = effects:FindFirstChild("Modules") if not modules then return nil end local mod = modules:FindFirstChild("SettingData") if not mod then return nil end return require(mod) end) if not ok or type(SettingData) ~= "table" then return end MainModule._SettingData = SettingData local FakeSettings = MainModule.FakeSettings local function updateGameTables(tbl) for k, v in pairs(tbl) do if k == "Custom Clothing Color" then tbl[k] = FakeSettings["Custom Clothing Color"] elseif k == "Custom Ability Color" then tbl[k] = FakeSettings["Custom Ability Color"] elseif typeof(v) == "table" and v ~= tbl then updateGameTables(v) end end end MainModule._updateGameTables = updateGameTables for key, fn in pairs(SettingData) do if typeof(fn) == "function" then local original = fn SettingData[key] = function(self, ...) local args = {...} if typeof(self) == "string" and FakeSettings[self] ~= nil then return FakeSettings[self] end if typeof(args[1]) == "string" and FakeSettings[args[1]] ~= nil then return FakeSettings[args[1]] end return original(self, ...) end end end end end task.spawn(function() pcall(MainModule.InitSettingDataSpoof) end) if not MainModule.UpdateVIPClothes then function MainModule.UpdateVIPClothes() MainModule.FakeSettings["Custom Clothing Color"] = MainModule.ClothesColorEnabled pcall(function() if MainModule._updateGameTables and MainModule._SettingData then MainModule._updateGameTables(MainModule._SettingData) end end) local col = MainModule.ClothesColor or Color3.fromRGB(255, 255, 255) MainModule.UniformColorValue = col MainModule.SetUniformSkinEnabled = MainModule.ClothesColorEnabled _G.UniformColorValue = col _G.SetUniformSkinEnabled = MainModule.ClothesColorEnabled pcall(function() if MainModule.ClothesColorEnabled then LocalPlayer:SetAttribute("ClothingColor", col) LocalPlayer:SetAttribute("UniformColorValue", col) LocalPlayer:SetAttribute("ClothingColorToggle", true) LocalPlayer:SetAttribute("SetUniformSkinEnabled", true) else LocalPlayer:SetAttribute("ClothingColor", nil) LocalPlayer:SetAttribute("UniformColorValue", nil) LocalPlayer:SetAttribute("ClothingColorToggle", false) LocalPlayer:SetAttribute("SetUniformSkinEnabled", false) end end) end end if not MainModule.toggle_custom_uniform_color then function MainModule.toggle_custom_uniform_color(enabled) MainModule.ClothesColorEnabled = enabled and true or false MainModule.UpdateVIPClothes() if PlayToggleSound then PlayToggleSound() end return true end MainModule.toggle_clothes_color = MainModule.toggle_custom_uniform_color end if not MainModule.set_uniform_color then function MainModule.set_uniform_color(col) if typeof(col) == "Color3" then MainModule.ClothesColor = col if MainModule.ClothesColorEnabled then MainModule.UpdateVIPClothes() end end end end if not MainModule.UpdateVIPVFX then function MainModule.UpdateVIPVFX() MainModule.FakeSettings["Custom Ability Color"] = MainModule.VFXColorEnabled pcall(function() if MainModule._updateGameTables and MainModule._SettingData then MainModule._updateGameTables(MainModule._SettingData) end end) end end local e = t:Section({ Title = "Emotes", Icon = "music", Opened = true }) local selectedEmote = emoteNames and emoteNames[1] or nil local emoteDrop emoteDrop = MainModule.UIDropdown(e, { Title = "Select Emote", Desc = "Choose an emote to play", Values = emoteNames or {"None"}, Value = (emoteNames and emoteNames[1]) or "None", Callback = function(v) selectedEmote = v end }) MainModule.UIInput(e, { Title = "Search Emote", Value = "", Callback = function(value) if not emoteNames then return end local filtered = {} if value and value ~= "" then for _, name in ipairs(emoteNames) do if string.lower(name):find(string.lower(value), 1, true) then table.insert(filtered, name) end end else filtered = emoteNames end if #filtered == 0 then filtered = {"No results"} end pcall(function() if emoteDrop.Refresh then emoteDrop:Refresh(filtered) elseif emoteDrop.SetValues then emoteDrop:SetValues(filtered) end end) end }) e:Button({ Title = "Play Emote", Desc = "Play selected emote (it also plays the sound of emote btw)", Callback = function() local data = nil for _, em in ipairs(EmotesList or {}) do if em.Name == selectedEmote then data = em; break end end if data then PlayEmote(data) else HSXNotify("Emote", "Select an emote", 0.8) end end }) e:Button({ Title = "Stop Emote", Desc = "Stop current emote", Callback = function() StopCurrentEmote() HSXNotify("Emote", "Stopped", 0.6) end }) end do local t = Window:Tab({ Title = "Anniversary", Icon = "star", Desc = "Balloons, Peaberts, Anniversary" }) local s = t:Section({ Title = "Balloons", Icon = "party-popper", Opened = true }) MainModule.UIToggle(s, { Id = "BalloonESP", Title = "Balloon ESP", Desc = "shows a tracer and notification to ballons when they are spawns", Value = false, Callback = function(v) if PlayToggleSound then PlayToggleSound() end; sc(MainModule.toggle_balloon_esp, v) end }) MainModule.HSXToggleWithKey(s, "Auto Teleport to Balloons", "BalloonTP", "None", function() return MainModule.BalloonData and MainModule.BalloonData.TPEnabled end, function(v) if PlayToggleSound then PlayToggleSound() end; sc(MainModule.toggle_balloon_teleport, v); return true end, "automatically teleport u to the ballon when they are available for pick up") local p = t:Section({ Title = "Peaberts", Icon = "skull", Opened = true }) MainModule.UIToggle(p, { Id = "InstantKillPeaberts", Title = "Instant Kill Peaberts", Desc = "auto kill all admin abuse evil peaberts", Value = false, Callback = function(v) sc(MainModule.toggle_peabert_kill, v) end }) MainModule.UISlider(p, { Title = "Shots Per Tick", Desc = "Shots fired per tick for peabert kill", Value = {Min=1,Max=50,Default=15}, Step=1, Callback = function(v) sc(MainModule.set_peabert_shots_per_tick, v) end }) MainModule.UIToggle(p, { Id = "PeabertESP", Title = "Peabert ESP", Desc = "ESP + Tracers on peaberts that gives power rolls.", Value = false, Callback = function(v) sc(MainModule.toggle_peabert_esp, v) end }) p:Button({ Title = "TP to Peabert", Desc = "Teleport to nearest peabert", Callback = function() sc(MainModule.tp_to_peaberts) end }) end do local t = Window:Tab({ Title = "Extras", Icon = "sparkles", Desc = "Auto features & more" }) local a = t:Section({ Title = "Auto Features", Icon = "bot", Opened = true }) MainModule.UIToggle(a, { Id = "AutoWin", Title = "Auto Win", Desc = "Automatically teleports to end/safezone in RLGL, Dalgona, Light's out, HideAndSeek (Only Hider), JumpRope, GlassBridge", Value = false, Callback = function(v) sc(MainModule.toggle_auto_win, v) end }) MainModule.UIToggle(a, { Id = "AutoNextGame", Title = "Auto Next Game", Desc = "Automatically teleports you to the next game", Value = false, Callback = function(v) sc(MainModule.toggle_auto_next_game, v) end }) MainModule.UIToggle(a, { Id = "SafePlaceLowHealth", Title = "Safe Place on Low Health", Desc = "Teleports you to 100 blocks up when you have 30 HP or lowest", Value = false, Callback = function(v) sc(MainModule.toggle_auto_safe, v) end }) MainModule.UIToggle(a, { Id = "AutoSkipDialogues", Title = "Auto Skip Dialogues", Desc = "Skip dialogue prompts", Value = false, Callback = function(v) sc(MainModule.toggle_auto_skip, v) end }) MainModule.UIToggle(a, { Id = "AutoCollectBandage", Title = "Auto Collect Bandage", Desc = "Auto teleport u to the bandage if you dont have one", Value = false, Callback = function(v) sc(MainModule.toggle_auto_collect_bandage, v) end }) MainModule.UIToggle(a, { Id = "AutoCollectFlashbang", Title = "Auto Collect Flashbang", Desc = "Auto teleport u to the flashbang if you dont have one", Value = false, Callback = function(v) sc(MainModule.toggle_auto_collect_flashbang, v) end }) MainModule.UIToggle(a, { Id = "AutoCollectGrenade", Title = "Auto Collect Grenade", Desc = "Auto teleport u to the grenade if you dont have one", Value = false, Callback = function(v) sc(MainModule.toggle_auto_collect_grenade, v) end }) MainModule.UIToggle(a, { Id = "AutoVote", Title = "Auto Vote", Desc = "Auto vote keep/stop", Value = false, Callback = function(v) sc(MainModule.toggle_auto_vote, v) end }) MainModule.UIDropdown(a, { Title = "Vote Option", Values = {"KeepPlaying","StopPlaying"}, Value = "KeepPlaying", Callback = function(v) sc(MainModule.set_vote_option, v) end }) MainModule.UIToggle(a, { Id = "RageAutoQTE", Title = "RAGE Auto QTE", Desc = "Auto pressing QTE when they are spawn", Value = false, Callback = function(v) sc(MainModule.toggle_rage_auto_qte, v) end }) MainModule.UIToggle(a, { Id = "LegitAutoQTE", Title = "Legit Auto QTE", Desc = "Normally pressing auto QTE in timing", Value = false, Callback = function(v) sc(MainModule.toggle_legit_auto_qte, v) end }) local s = t:Section({ Title = "Misc Extras", Icon = "sparkles", Opened = true }) MainModule.UIToggle(s, { Id = "RemoveAnniversaryDecor", Title = "Remove Anniversary Decor", Desc = "Deletes all anniversary decorations to prevent lags on bad devices", Value = false, Callback = function(v) sc(MainModule.toggle_remove_anniversary, v) end }) MainModule.UIToggle(s, { Id = "FakeExploiter", Title = "Fake Exploiter", Desc = "makes nearest target flying and using speedhack ONLY FOR YOU so you can report them in ink support", Value = false, Callback = function(v) sc(MainModule.toggle_fake_exploiter, v) end }) MainModule.UIToggle(s, { Id = "AutoThrow", Title = "Auto Throw", Desc = "F / mobile button throw + face target helper", Value = false, Callback = function(v) sc(MainModule.toggle_auto_throw, v) end }) MainModule.UIToggle(s, { Id = "TugOfWarQTE", Title = "Enable Tug of War QTE", Desc = "enables tug of war qte good if you want to test or just to practice", Value = false, Callback = function(v) sc(MainModule.toggle_tug_of_war_qte, v) end }) MainModule.UIToggle(s, { Id = "Ambience", Title = "Ambience", Value = false, Callback = function(v) sc(MainModule.toggle_ambience, v) end }) MainModule.UIToggle(s, { Id = "AntiFall", Title = "Anti Fall", Desc = "Semi-transparent platform under you (works everywhere)", Value = false, Callback = function(v) sc(MainModule.toggle_global_anti_fall, v) end }) s:Button({ Title = "Teleport Up 100", Callback = function() sc(MainModule.teleport_up) end }) s:Button({ Title = "Teleport Down 40", Callback = function() sc(MainModule.teleport_down) end }) local titleDrop MainModule.UIToggle(s, { Id = "FreeTitle", Title = "Free Title", Value = false, Callback = function(v) sc(MainModule.toggle_free_title, v) MainModule.HSXShowHide(titleDrop, v) end }) titleDrop = MainModule.UIDropdown(s, { Title = "Select Title", Values = {"Manipulator","Rich Millionaire","Rich Billionaire","Fallen Angel","Zeus","Content Creator","Aura Farmer","The Recruiter","Tanos","The Glass Maker","Frontman","Squidder","Game VIP","Sackboy","Him","Honeycomb Artist","The Chosen One","Game Developer","Game Administrator","The Strongest","The Perfect Lifeform","Mastermind","King of Curses","Escape Artist","Protagonist"}, Value = "Rich Billionaire", Callback = function(v) sc(MainModule.set_title, v) end }) MainModule.HSXShowHide(titleDrop, false) local gp = t:Section({ Title = "Free Gamepasses", Icon = "gift", Opened = true }) gp:Button({ Title = "Free VIP", Callback = function() sc(MainModule.unlock_vip) end }) MainModule.UIToggle(gp, { Id = "PermanentGuard", Title = "Permanent Guard", Value = false, Callback = function(v) sc(MainModule.toggle_permanent_guard, v) end }) MainModule.UIToggle(gp, { Id = "CustomPlayerTag", Title = "Custom Player Tag", Value = false, Callback = function(v) sc(MainModule.toggle_custom_player_tag, v) end }) MainModule.UIToggle(gp, { Id = "PrivateServerPlus", Title = "Private Server Plus", Value = false, Callback = function(v) sc(MainModule.toggle_private_server_plus, v) end }) MainModule.UIToggle(gp, { Id = "Lighter", Title = "Lighter", Value = false, Callback = function(v) sc(MainModule.toggle_lighter, v) end }) MainModule.UIToggle(gp, { Id = "GlassVision", Title = "Glass Vision", Value = false, Callback = function(v) sc(MainModule.toggle_glass_vision, v) end }) end do local t = Window:Tab({ Title = "Settings", Icon = "settings", Desc = "Menu, configs, themes" }) local rawTab = t._raw or t local MenuBox = t:Section({ Title = "Menu", Icon = "menu", Opened = true }) MenuBox:Dropdown({ Title = "Notification Side", Values = { "Left", "Right" }, Value = "Right", Callback = function(Value) pcall(function() Library:SetNotifySide(Value) end) end }) MenuBox:Toggle({ Title = "Always On Top", Desc = "Keep HollyScriptX above other UI", Value = true, Callback = function(State) pcall(function() if Library.SetAlwaysOnTop then Library:SetAlwaysOnTop(State and true or false) elseif Library.AlwaysOnTop ~= nil then Library.AlwaysOnTop = State and true or false end if Window and Window.SetAlwaysOnTop then Window:SetAlwaysOnTop(State and true or false) end end) end }) MenuBox:Toggle({ Title = "Background Blur", Desc = "Acrylic/blur behind the menu when open", Value = true, Callback = function(State) pcall(function() if Library.ToggleAcrylic then Library:ToggleAcrylic(State and true or false) elseif Library.SetAcrylic then Library:SetAcrylic(State and true or false) elseif Library.Acrylic ~= nil then Library.Acrylic = State and true or false end if Library.BackgroundBlur ~= nil then Library.BackgroundBlur = State and true or false end end) end }) pcall(function() MainModule.Keybinds = MainModule.Keybinds or {} MainModule.Keybinds.Menu = MainModule.Keybinds.Menu or "Z" local def = MainModule.Keybinds.Menu if not def or def == "" or def == "None" then def = "Z" end local rawGb = MenuBox._raw or MenuBox local label = rawGb.AddLabel and rawGb:AddLabel("Menu bind") or nil local kp if label and label.AddKeyPicker then kp = label:AddKeyPicker("MenuKeybind", { Default = def, Mode = "Toggle", Text = "Menu keybind", NoUI = true, }) end if Library.Options and Library.Options.MenuKeybind then Library.ToggleKeybind = Library.Options.MenuKeybind elseif kp then Library.ToggleKeybind = kp elseif Enum.KeyCode[def] then Library.ToggleKeybind = Enum.KeyCode[def] else Library.ToggleKeybind = Enum.KeyCode.Z end end) MenuBox:Dropdown({ Title = "DPI Scale", Values = { "50", "75", "80", "85", "90", "100", "125", "150", "175", "200" }, Value = "100", Callback = function(Value) Library:SetDPIScale(tonumber(Value) or 100) PlayBell() end }) MenuBox:Button({ Title = "Unload Script", Callback = function() pcall(function() if MainModule.cleanup_everything then MainModule.cleanup_everything() end end) cursorVisible = false pcall(function() if _G.HollyScriptX_CursorDrawings then for _, d in ipairs(_G.HollyScriptX_CursorDrawings) do pcall(function() d.Visible = false; if d.Remove then d:Remove() end end) end end end) pcall(function() if Window and Window.Destroy then Window:Destroy() end end) pcall(function() if Library and Library.Unload then Library:Unload() end end) HSXNotify("HollyScriptX", "Unloaded", 0.8) end }) local MenuKeybinds = t:Section({ Title = "Keybinds", Icon = "keyboard", Opened = true }) MenuKeybinds:Toggle({ Title = "Show Keybinds Menu", Desc = "Show floating keybinds panel", Value = false, Callback = function(State) pcall(function() if Library.KeybindFrame then Library.KeybindFrame.Visible = State and true or false end end) end }) pcall(function() ThemeManager:SetLibrary(Library) ThemeManager:SetFolder("HollyScriptX") ThemeManager:ApplyToTab(rawTab) end) pcall(function() SaveManager:SetLibrary(Library) SaveManager:IgnoreThemeSettings() SaveManager:SetIgnoreIndexes({ "MenuKeybind" }) SaveManager:SetFolder("HollyScriptX") SaveManager:BuildConfigSection(rawTab) SaveManager:LoadAutoloadConfig() end) local cr = t:Section({ Title = "Credits", Icon = "heart", Opened = true }) cr:Paragraph({ Title = "whonixx - script owner" }) cr:Paragraph({ Title = "shades - script owner" }) cr:Paragraph({ Title = "insected - helped with obf/dc server" }) cr:Paragraph({ Title = "chillnie - script tester/co-owner" }) cr:Paragraph({ Title = "rezorn - script helper/developer" }) end pcall(function() local mk = (MainModule.Keybinds and MainModule.Keybinds.Menu) or "Z" if Window.SetToggleKey and Enum.KeyCode[mk] then Window:SetToggleKey(Enum.KeyCode[mk]) end end) task.defer(function() task.wait(0.3) local url = "https://discord.gg/hollyscriptx-1504482964661076098" pcall(function() if setclipboard then setclipboard(url) end end) pcall(function() if toclipboard then toclipboard(url) end end) HSXNotify("HollyScriptX", "discord.gg/hollyscriptx-1504482964661076098 link copied to ur clipboard", 2) end) pcall(function() if Library.Options and Library.Options.MenuKeybind then Library.ToggleKeybind = Library.Options.MenuKeybind end end) print("[HollyScriptX] guguugguugagagagagagaagag")